• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Scutellaria Baicalensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

ACCTGTTGAAGGATCATTGTCGAAACCTGTGAATGCAGATCACGAACATGTGTCTAACGACCAATCGAGGGCAACGGCGTGAGGGTGTGTCCCCCGTTGGAGTCCTCACACCCGTGTGGCCGCCGCAAGAGCATCGCGTCGTGCGGGCCAACGAACCCAGGTACAGAATGCGCCATGAAAACCAAAATAGATTATCCCTCCTCTGTGCGTCACGTTCGCGGAGCACACACCGGGTGGGTCAGGCGTCTATCGAACGTCATAATGACTCTCGGCAATGGATATCTCGGCTCTCGCATCAATGAAGAACGTAGTGAAATGTGATACTTAGTTTGAATTACAGAATCCTGTGAACCATCTAGTCATTGAACGCAAGTTGCGCCAGAAGCCATCAGGCCGAGGGCACGTCTGCCTGGACGTCACGCATCATGTTGCCCTCTTGCACCGCCTCGAGCGGTGCCGTGTGGGGGGTGAAGATTGGCCCCCCGTGCACCCCGGTACGTGGCCGGCCCAAATATGATCCCCAGCGACGCACGCCGATAAGTGGTGGTTGTTTCCTCAACTCGTGTGCTGTTGTGTGCTAAGGCGTCGTCAGTTCAGAAGAGAATCGAAAGATACACCATCGTGCCATCATGCCATCGACCGTGACCCCAGGTCAGGCGGGATTAC

Click for details-----ITS1

ACCTGTTGAAGGATCATTGTCGAAACCTGTGAATGCAGATCACGAACATGTGTCTAACGACCAATCGAGGGCAACGGCGTGAGGGTGTGTCCCCCGTTGGAGTCCTCACACCCGTGTGGCCGCCGCAAGAGCATCGCGTCGTGCGGGCCAACGAACCCAGGTACAGAATGCGCCATGAAAACCAAAATAGATTATCCCTCCTCTGTGCGTCACGTTCGCGGAGCACACACCGGGTGGGTCAGGCGTCTATCGAACGTCATAA

Click for details-----ITS2

ATCATGTTGCCCTCTTGCACCGCCTCGAGCGGTGCCGTGTGGGGGGTGAAGATTGGCCCCCCGTGCACCCCGGTACGTGGCCGGCCCAAATATGATCCCCAGCGACGCACGCCGATAAGTGGTGGTTGTTTCCTCAACTCGTGTGCTGTTGTGTGCTAAGGCGTCGTCAGTTCAGAAGAGAATCGAAAGATACACCATCGTGCCATCATGCCATCGACCGTGACCCCAGGTCAGGCGGGATTAC
Taxonomic Information

Plant ID: NPO28877
Plant Latin Name: Scutellaria Baicalensis
Taxonomy Genus: Scutellaria
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 65409
Plant-of-the-World-Online: 458155-1

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM; Kampo


Medicinal Functions:

Anodyne; Antibacterial; Anticholesterolemic; Antipyretic; Antispasmodic; Astringent; Cancer; Cholagogue; Diuretic; Expectorant; Febrifuge; Haemostatic; Laxative; Nervine; Sedative; Stomachic; TB; Tonic

Geographical Distribution

South Africa; Mongolia; Vietnam; China; South Korea; Russia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

161 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


111 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

65 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95676

Ingredient ID: NPC94304

Ingredient ID: NPC94218

Ingredient ID: NPC94045

Ingredient ID: NPC93033

Ingredient ID: NPC92659

Ingredient ID: NPC90787

Ingredient ID: NPC88072

Ingredient ID: NPC86433

Ingredient ID: NPC85813

Ingredient ID: NPC85327

Ingredient ID: NPC82648

Ingredient ID: NPC82363

Ingredient ID: NPC81775

Ingredient ID: NPC79527

Ingredient ID: NPC78540

Ingredient ID: NPC76145

Ingredient ID: NPC70744

Ingredient ID: NPC70136

Ingredient ID: NPC66700

Ingredient ID: NPC649

Ingredient ID: NPC62086

Ingredient ID: NPC61307

Ingredient ID: NPC6119

Ingredient ID: NPC61104

Ingredient ID: NPC60669

Ingredient ID: NPC59303

Ingredient ID: NPC5708

Ingredient ID: NPC55612

Ingredient ID: NPC54626

Ingredient ID: NPC50898

Ingredient ID: NPC4827

Ingredient ID: NPC45618

Ingredient ID: NPC44659

Ingredient ID: NPC43212

Ingredient ID: NPC43211

Ingredient ID: NPC4125

Ingredient ID: NPC3922

Ingredient ID: NPC3649

Ingredient ID: NPC3190

Ingredient ID: NPC318235

Ingredient ID: NPC312391

Ingredient ID: NPC311629

Ingredient ID: NPC311343

Ingredient ID: NPC306821

Ingredient ID: NPC306616

Ingredient ID: NPC306607

Ingredient ID: NPC306462

Ingredient ID: NPC302857

Ingredient ID: NPC301323

Ingredient ID: NPC299529

Ingredient ID: NPC296197

Ingredient ID: NPC294852

Ingredient ID: NPC293183

Ingredient ID: NPC284819

Ingredient ID: NPC284498

Ingredient ID: NPC281994

Ingredient ID: NPC280717

Ingredient ID: NPC27794

Ingredient ID: NPC277467

Ingredient ID: NPC275124

Ingredient ID: NPC274909

Ingredient ID: NPC270074

Ingredient ID: NPC269806

Ingredient ID: NPC268533

Ingredient ID: NPC266021

Ingredient ID: NPC26583

Ingredient ID: NPC265513

Ingredient ID: NPC264735

Ingredient ID: NPC262253

Ingredient ID: NPC261831

Ingredient ID: NPC261619

Ingredient ID: NPC259713

Ingredient ID: NPC259706

Ingredient ID: NPC258723

Ingredient ID: NPC257522

Ingredient ID: NPC25676

Ingredient ID: NPC254976

Ingredient ID: NPC249045

Ingredient ID: NPC249018

Ingredient ID: NPC243601

Ingredient ID: NPC239312

Ingredient ID: NPC237435

Ingredient ID: NPC237002

Ingredient ID: NPC235165

Ingredient ID: NPC231772

Ingredient ID: NPC229403

Ingredient ID: NPC225406

Ingredient ID: NPC225284

Ingredient ID: NPC224462

Ingredient ID: NPC223417

Ingredient ID: NPC222830

Ingredient ID: NPC219573

Ingredient ID: NPC215702

Ingredient ID: NPC214138

Ingredient ID: NPC213322

Ingredient ID: NPC213216

Ingredient ID: NPC210094

Ingredient ID: NPC20892

Ingredient ID: NPC207869

Ingredient ID: NPC207725

Ingredient ID: NPC206380

Ingredient ID: NPC202691

Ingredient ID: NPC200855

Ingredient ID: NPC197378

Ingredient ID: NPC197316

Ingredient ID: NPC196776

Ingredient ID: NPC194383

Ingredient ID: NPC186653

Ingredient ID: NPC18511

Ingredient ID: NPC183953

Ingredient ID: NPC183878

Ingredient ID: NPC181912

Ingredient ID: NPC181582

Ingredient ID: NPC180612

Ingredient ID: NPC178859

Ingredient ID: NPC17458

Ingredient ID: NPC174493

Ingredient ID: NPC173658

Ingredient ID: NPC170526

Ingredient ID: NPC170070

Ingredient ID: NPC169454

Ingredient ID: NPC167976

Ingredient ID: NPC166894

Ingredient ID: NPC164086

Ingredient ID: NPC163424

Ingredient ID: NPC158151

Ingredient ID: NPC157923

Ingredient ID: NPC156953

Ingredient ID: NPC153830

Ingredient ID: NPC15292

Ingredient ID: NPC152280

Ingredient ID: NPC149570

Ingredient ID: NPC149487

Ingredient ID: NPC149203

Ingredient ID: NPC148677

Ingredient ID: NPC147628

Ingredient ID: NPC143894

Ingredient ID: NPC142871

Ingredient ID: NPC142703

Ingredient ID: NPC142540

Ingredient ID: NPC137167

Ingredient ID: NPC136745

Ingredient ID: NPC135602

Ingredient ID: NPC131624

Ingredient ID: NPC130230

Ingredient ID: NPC127661

Ingredient ID: NPC127447

Ingredient ID: NPC125962

Ingredient ID: NPC124853

Ingredient ID: NPC124478

Ingredient ID: NPC121886

Ingredient ID: NPC121270

Ingredient ID: NPC120464

Ingredient ID: NPC119508

Ingredient ID: NPC114239

Ingredient ID: NPC112394

Ingredient ID: NPC111897

Ingredient ID: NPC110661

Ingredient ID: NPC105380

Ingredient ID: NPC100178