• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Veronica Liwanensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGATGCCTGTAAATCAGACCGCGAACACGTGTTAATAAGCTCCGTCCGCTCAGCGCTTGCGCTTAGCGGGCTCACGAACCCCGGCGCGGAAAGCGCCAAGGAAAACTTAAAGGAAGCGTCGCCCTCGAGCGCCCGTTCGCGGTGCGTCTTGGGTGCGCGGCGTCCCTCAAATGTCTAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO28819
Plant Latin Name: Veronica Liwanensis
Taxonomy Genus: Veronica
Taxonomy Family: Plantaginaceae

Plant External Links:

NCBI TaxonomyDB: 165337
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

66 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


56 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

21 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99321

Ingredient ID: NPC87466

Ingredient ID: NPC83546

Ingredient ID: NPC79027

Ingredient ID: NPC75485

Ingredient ID: NPC52214

Ingredient ID: NPC50488

Ingredient ID: NPC48919

Ingredient ID: NPC47294

Ingredient ID: NPC4509

Ingredient ID: NPC42564

Ingredient ID: NPC40175

Ingredient ID: NPC36002

Ingredient ID: NPC35655

Ingredient ID: NPC31409

Ingredient ID: NPC304429

Ingredient ID: NPC300098

Ingredient ID: NPC298410

Ingredient ID: NPC295038

Ingredient ID: NPC293427

Ingredient ID: NPC292952

Ingredient ID: NPC285802

Ingredient ID: NPC277907

Ingredient ID: NPC277525

Ingredient ID: NPC276466

Ingredient ID: NPC273965

Ingredient ID: NPC273069

Ingredient ID: NPC272471

Ingredient ID: NPC262094

Ingredient ID: NPC256040

Ingredient ID: NPC250667

Ingredient ID: NPC249122

Ingredient ID: NPC247945

Ingredient ID: NPC246392

Ingredient ID: NPC246224

Ingredient ID: NPC244942

Ingredient ID: NPC243728

Ingredient ID: NPC230301

Ingredient ID: NPC224224

Ingredient ID: NPC217727

Ingredient ID: NPC209451

Ingredient ID: NPC208094

Ingredient ID: NPC206276

Ingredient ID: NPC201767

Ingredient ID: NPC199703

Ingredient ID: NPC193142

Ingredient ID: NPC190358

Ingredient ID: NPC1898

Ingredient ID: NPC185556

Ingredient ID: NPC178464

Ingredient ID: NPC174362

Ingredient ID: NPC172193

Ingredient ID: NPC170084

Ingredient ID: NPC169275

Ingredient ID: NPC168990

Ingredient ID: NPC168248

Ingredient ID: NPC15702

Ingredient ID: NPC152506

Ingredient ID: NPC149496

Ingredient ID: NPC139954

Ingredient ID: NPC113733

Ingredient ID: NPC108758

Ingredient ID: NPC108292

Ingredient ID: NPC107712

Ingredient ID: NPC106508

Ingredient ID: NPC106021