CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Xylocarpus Granatum

Example Image

PLANiTS DNA barcode

Click for details-----ITS

AGGTGACCTGCGGAAGGATCATTGTCGAAACCTGCGCCGCAGGACGGCCCGCGAACTCGTGACCGATTGCACCCGCGGGGGCGGATTGTCGGGCTCCCGACTTCCGCCGCCGCGCAGCCCGCGGGGGGGGGCCGAGACGTTCGTCTCCCCTACCGTCGCGAAACAACAAACCCCGGCGCGGTCCGCGCCAAGGACAGTCAAAGGGAGGAGCGTTCTCCCGCCCCGCACCGGACGCGGCGCGCGGGGGGTTTTCCGCCCTCTTTCGTCAAAAATCCAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGTTGCCCCCCGCCAACCCCCCTCGGGGGCATTGTCGGGCGGGCGGAGTCGGGCCTCCCGTTCTCCCCCCTCCCCTCCCTTGCGGTTGGCCCAAATTCAAGTCTTCGGCGGCCATGCCACGACAATGGGGGGCGGCAAGCACTTAAGGCCTCGAGCACTGGTCGTGCATTGAATTCCCCGTGCATCACGCGCTCATGGACCCCCTTCGGACACCCTCTTTGCGACCCCAGGTCAGGCGGGACCAC

Click for details-----ITS1

Click for details-----ITS2

ATCATTGCCCCCCCCCCCCACCCCCCCCTTGGGCATACGCGGGGGGGCGGAATATGGCCTCCCGTTCTCCCCCCCCCTTTCCTTTGCCATTGGCCGTTTTCGGCTACGTTGGGCTCGGCAACAGGGGTTGAGAGACAATCTTAATGCGCCCCGCGCTGGGTCGTCGTTGTATATTCCCTGGATTTAAACGTTTCATGCCTTTGGCCCCTCGTTATGCGAAACCACGGGCTGAGTTTACCCACATCTATTTTAGTAGGAACATTTAAGCGAGGAA

Taxonomic Information

Plant ID: NPO28813
Plant Latin Name: Xylocarpus Granatum
Taxonomy Genus: Xylocarpus
Taxonomy Family: Meliaceae

Plant External Links:

NCBI TaxonomyDB: 241841
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Philippines; India; Rwanda; Thailand; Kenya; Tanzania

Traditional Medicine System:

Indian Folk; Siddha

Geographical Distribution

Philippines; India; Rwanda; Thailand; Kenya; Tanzania

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

39 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

19 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

24 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC77272

Ingredient ID: NPC60973

Ingredient ID: NPC5284

Ingredient ID: NPC5079

Ingredient ID: NPC486652

Ingredient ID: NPC486651

Ingredient ID: NPC486650

Ingredient ID: NPC486649

Ingredient ID: NPC486648

Ingredient ID: NPC478084

Ingredient ID: NPC473260

Ingredient ID: NPC473259

Ingredient ID: NPC470806

Ingredient ID: NPC469524

Ingredient ID: NPC469485

Ingredient ID: NPC469342

Ingredient ID: NPC469333

Ingredient ID: NPC469332

Ingredient ID: NPC469331

Ingredient ID: NPC329938

Ingredient ID: NPC319531

Ingredient ID: NPC314350

Ingredient ID: NPC289720

Ingredient ID: NPC282001

Ingredient ID: NPC280391

Ingredient ID: NPC270796

Ingredient ID: NPC241354

Ingredient ID: NPC227466

Ingredient ID: NPC209364

Ingredient ID: NPC207292

Ingredient ID: NPC203541

Ingredient ID: NPC200188

Ingredient ID: NPC196864

Ingredient ID: NPC178932

Ingredient ID: NPC175446

Ingredient ID: NPC173544

Ingredient ID: NPC16163

Ingredient ID: NPC142113

Ingredient ID: NPC110322

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	57

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00100230	DHA and X-Linked Retinitis Pigmentosa	retinitis pigmentosa	Doconexent (NPC270796)	NP level
NCT00266825	DHA Supplementation and Pregnancy Outcome	pregnancy	Doconexent (NPC270796)	NP level
NCT02690857	Study of Docosahexanoic Acid in Patients With Cystic Fibrosis (CF)	cystic fibrosis	Doconexent (NPC270796)	NP level
NCT03122912	Explore Effects of Dietary Fish Oil in Human Skin	aging	Doconexent (NPC270796)	NP level
NCT00646360	Effects of Prenatal DHA Supplements on Infant Development	pregnancy	Doconexent (NPC270796)	NP level
NCT05169060	Omega-3 Fatty Acid Lipidomics in Diabetes Peripheral Neuropathy	diabetic neuropathy	Doconexent (NPC270796)	NP level
NCT02939079	Evaluating of the Effect of Fingolimod With Fish Oil on Relapsing-Remitting Multiple Sclerosis Patients	multiple sclerosis	Doconexent (NPC270796)	NP level
NCT02057406	Omega 3 for Treatment of Depression in Patients With Heart Failure	depressive disorder	Doconexent (NPC270796)	NP level
NCT00440050	DHA (Docosahexaenoic Acid), an Omega 3 Fatty Acid, in Slowing the Progression of Alzheimer's Disease	Alzheimer disease	Doconexent (NPC270796)	NP level
NCT01007110	Effects of Docosahexaenoic Acid (DHA) on Fetal Cardiac Outcomes	pregnancy	Doconexent (NPC270796)	NP level
NCT00336336	GISSI-HF- Effects of n-3 PUFA and Rosuvastatin on Mortality-Morbidity of Patients With Symptomatic CHF	heart failure	Doconexent (NPC270796)	NP level
NCT00361374	Safety and Effectiveness of Omega 3-Fatty Acids, EPA Versus DHA, for the Treatment of Major Depression	major depressive disorder	Doconexent (NPC270796)	NP level
NCT05121766	Feasibility Pilot Clinical Trial of Omega-3 Supplement vs. Placebo for Post Covid-19 Recovery Among Health Care Workers	COVID-19	Doconexent (NPC270796)	NP level
NCT00516178	Intravenous Fish Oil in Critically Ill Cardiac Patients	coronary artery disease	Doconexent (NPC270796)	NP level
NCT03831178	Docosahexaenoic Acid (DHA) for Women With Breast Cancer in the Neoadjuvant Setting	breast cancer	Doconexent (NPC270796)	NP level
NCT03345550	OPTIMA-TBI Pilot Study	concussion	Doconexent (NPC270796)	NP level
NCT02550860	Influence of Fish Oil Based Intravenous Fat Emulsions on the Epidermal Barrier Function	intestinal disease	Doconexent (NPC270796)	NP level
NCT00711971	Does Fish Oil Prevent Depression in Pregnancy and Postpartum?	depressive disorder	Doconexent (NPC270796)	NP level
NCT01563913	Reducing Dyskinesia in Parkinson's Disease With Omega-3 Fatty Acids	Parkinson disease	Doconexent (NPC270796)	NP level
NCT00681408	Omega 3 Fish Oil Supplements vs. Placebo for Patients With Non-alcoholic Steatohepatitis (NASH)	Hepatic steatosis;non-alcoholic fatty liver disease	Doconexent (NPC270796)	NP level
NCT03402789	Docosahexaenoic Acid (DHA) Supplementation in Amblyopia	amblyopia	Doconexent (NPC270796)	NP level
NCT01547910	Effect of Supplementation of Fish Oil on Non-alcoholic Fatty Liver Disease in Children	non-alcoholic fatty liver disease	Doconexent (NPC270796)	NP level
NCT00333554	Nutritional Intervention to Prevent Diabetes	type 1 diabetes mellitus	Doconexent (NPC270796)	NP level
NCT00749307	Effects of Docosahexaenoic Acid (DHA) on Heart Rate Variability in Elderly Patients	cardiac arrhythmia	Doconexent (NPC270796)	NP level
NCT01903525	DHA For The Treatment of Pediatric Concussion Related to Sports Injury	concussion	Doconexent (NPC270796)	NP level
NCT02626299	Assessment of DHA On Reducing Early Preterm Birth	premature birth	Doconexent (NPC270796)	NP level
NCT01049529	Effect of Docosahexaenoic Acid on the Inflammatory Response and Clinical Outcomes From Surgical Patients	Sepsis	Doconexent (NPC270796)	NP level
NCT02973360	Dose-Finding Study of SC411 in Children With Sickle Cell Disease	sickle cell anemia	Doconexent (NPC270796)	NP level
NCT00511810	Omega-3 Fatty Acids as Adjunct Treatment for Major Depressive Disorder	major depressive disorder	Doconexent (NPC270796)	NP level
NCT00655525	Omega-3 Fatty Acid Administration in Dialysis Patients	chronic kidney disease	Doconexent (NPC270796)	NP level
NCT01057615	Effect of Fish Oil and Vitamin C on Exercise-Induced Bronchoconstriction and Airway Inflammation in Asthma	asthma	Doconexent (NPC270796)	NP level
NCT02178410	VITAL Rhythm Study	cardiovascular disease	Doconexent (NPC270796)	NP level
NCT00047983	Omega-3 Fatty Acids That Affect the Immune System in Kidney Transplant Patients	kidney disease	Doconexent (NPC270796)	NP level
NCT02420496	Enteral Fish Oil is Superior to Ursodeoxycholic Acid (UDCA) and Placebo for the Treatment of Cholestasis in Infants	liver disease;cholestasis	Doconexent (NPC270796)	NP level
NCT02538484	Impact of Omega 3 Fatty Acid Supplementation on Aromatase in Obese Subjects	breast cancer	Doconexent (NPC270796)	NP level
NCT03613844	DHA Brain Delivery Trial	Alzheimer disease	Doconexent (NPC270796)	NP level
NCT01849250	Study of Docosahexaenoic Acid (DHA) in Triple Negative Breast Cancer Survivors	breast ductal carcinoma in situ;lobular breast carcinoma;Paget disease	Doconexent (NPC270796)	NP level
NCT02683317	Enteral Administration of Docosahexaenoic Acid to Prevent Retinopathy of Prematurity	retinopathy of prematurity	Doconexent (NPC270796)	NP level
NCT00871377	Double Blind, Crossover Study of Fish Oil [EPA and DHA] for Intractable Partial Seizures	epilepsy	Doconexent (NPC270796)	NP level
NCT01769092	Clinical Trial of the Effects of DHA in the Treatment of Seizure Disorders	epilepsy	Doconexent (NPC270796)	NP level
NCT00336908	Inflammatory Responses to Lipid Emulsions in Children Before and After Open Heart Surgery	inflammation	Doconexent (NPC270796)	NP level
NCT00221546	Influence of DHA-rich Supplement on DHA-status and Health Evolution of Patients With Cystic Fibrosis	cystic fibrosis	Doconexent (NPC270796)	NP level
NCT00485615	An Open Label Trial of Omega 3(o3mega+Joy)in the Treatment of Social Phobia	social anxiety disorder	Doconexent (NPC270796)	NP level
NCT00530244	Use of Formula Fortified With DHA in Infants With Cystic Fibrosis	cystic fibrosis	Doconexent (NPC270796)	NP level
NCT01259284	Fish Oil Versus Statins Versus Placebos in Reducing Atrial Fibrillation in Patients Undergoing Thoracic Surgery for Lung Cancer	cancer	Doconexent (NPC270796)	NP level
NCT00988585	Evaluation of the Safety and Biologic Effects of an Eicosapentaenoic (EPA)-Enriched Oil	heart disease	Doconexent (NPC270796)	NP level
NCT00060749	Effect of DHA Supplements on Macular Function in Patients With Stargardt Macular Dystrophy and Stargardt-like Macular Dystrophy	macular degeneration	Doconexent (NPC270796)	NP level
NCT01745510	Enteral Administration of Docosahexaenoic Acid to Prevent Necrotizing Enterocolitis in Preterm Neonates	necrotizing enterocolitis	Doconexent (NPC270796)	NP level
NCT01194063	Use of Omegaven Fish Oil Emulsion for Parenteral Nutrition Associated Liver Disease in Infants and Children	cholestasis	Doconexent (NPC270796)	NP level
NCT02517502	Docosahexaenoic Acid (DHA) To Prevent Development of Cognitive Dysfunction Due to Chemotherapy	Cognitive impairment	Doconexent (NPC270796)	NP level
NCT00447291	Safety & Efficacy of Omega-3 Fish Oil in Overweight Children & Adolescents	obesity	Doconexent (NPC270796)	NP level
NCT02021513	Pilot Study - Effect of Omega-3 on Systemic Lupus Erythematosus	systemic lupus erythematosus	Doconexent (NPC270796)	NP level
NCT00072982	Treatment of Rheumatoid Arthritis With Marine and Botanical Oils	rheumatoid arthritis	Doconexent (NPC270796)	NP level
NCT02487771	Kansas University DHA Outcome Study (KUDOS) Follow-Up	pregnancy	Doconexent (NPC270796)	NP level
NCT00658476	Omega-3 Fatty Acids for Treatment of Depression in Adolescents	depressive disorder	Doconexent (NPC270796)	NP level
NCT01796262	The Effects of DHA on Attention Deficit and Hyperactivity Disorder	attention deficit hyperactivity disorder	Doconexent (NPC270796)	NP level
NCT01661764	Fish Oil Supplementation, Nutrigenomics and Colorectal Cancer Prevention	colorectal adenoma	Doconexent (NPC270796)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Pregnancy/childbirth/puerperium maternal infection Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JB63	NCT02487771,NCT00646360,NCT00266825,NCT01007110
Depressive disorders, unspecified Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A7Z	NCT00711971,NCT00658476,NCT02057406
Cystic fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA25	NCT00221546,NCT00530244,NCT02690857
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	NCT00047983,NCT00655525
Obstruction of bile duct Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DC10.02	NCT01194063,NCT02420496
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	NCT03831178,NCT02538484
Epilepsy/seizure Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A61-8A6Z	NCT00871377,NCT01769092
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	NCT00681408,NCT01547910
Single episode depressive disorder, severe, without psychotic symptoms Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70.3	NCT00361374,NCT00511810
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	NCT03613844,NCT00440050
Concussion Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NA07.0	NCT03345550,NCT01903525
Diabetic polyneuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C03.0	NCT05169060
Retinopathy of prematurity Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71.3	NCT02683317
Ischemic heart disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40-BA6Z	NCT00988585
Neuropathy, ataxia, and retinitis pigmentosa Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C73.1	NCT00100230
Sepsis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G40-1G41	NCT01049529
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	NCT01057615
Impairment of binocular functions Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9D46	NCT03402789
Sickle-cell disorder Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A51	NCT02973360
Preterm newborn, unspecified Disease Category: 19.Certain conditions originating in the perinatal period Disease ICD-11 Code: KA21.4Z	NCT02626299
Social anxiety disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B04	NCT00485615
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	NCT01661764
Cardiac arrhythmia Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC9Z	NCT00749307
Ductal carcinoma in situ of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E65.2	NCT01849250
Bone paget disease Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB85	NCT01849250
Symptoms and signs involving cognition, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB21.Z	NCT02517502
Other specified non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92.Y	NCT00681408
Ageing associated decline in intrinsic capacity Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG2A	NCT03122912
Necrotising enterocolitis of newborn Disease Category: 19.Certain conditions originating in the perinatal period Disease ICD-11 Code: KB88	NCT01745510
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	NCT00072982
Diseases of the digestive system, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DE2Z	NCT02550860
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	NCT02939079
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	NCT00447291
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	NCT00336336
NA Disease Category: NA Disease ICD-11 Code: NA	NCT00336908
Liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB90-DB10Z	NCT02420496
Unspecified malignant neoplasms of unspecified sites Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D4Z	NCT01259284
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	NCT02021513
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	NCT01796262
COVID-19 Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D6Y	NCT05121766
coronary artery disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA8Y-BA8Z	NCT00516178
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	NCT01563913
Type1diabetesmellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A10	NCT00333554
Macular degeneration Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B75	NCT00060749
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	NCT02178410
Lobular carcinoma in situ of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E65.0	NCT01849250

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Xylocarpus Granatum

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

39 All known Ingredients in Total

19 Ingredients with Acceptable Bioavailablity

24 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Pregnancy/childbirth/puerperium maternal infection

Depressive disorders, unspecified

Cystic fibrosis

Chronic kidney disease

Obstruction of bile duct

Breast cancer

Epilepsy/seizure

Non-alcoholic fatty liver disease

Single episode depressive disorder, severe, without psychotic symptoms

Alzheimer disease

Concussion

Diabetic polyneuropathy

Retinopathy of prematurity

Ischemic heart disease

Neuropathy, ataxia, and retinitis pigmentosa

Sepsis

Asthma

Impairment of binocular functions

Sickle-cell disorder

Preterm newborn, unspecified

Social anxiety disorder

Colorectal cancer

Cardiac arrhythmia

Ductal carcinoma in situ of breast

Bone paget disease

Symptoms and signs involving cognition, unspecified

Other specified non-alcoholic fatty liver disease

Ageing associated decline in intrinsic capacity

Necrotising enterocolitis of newborn

Rheumatoid arthritis

Diseases of the digestive system, unspecified

Multiple sclerosis

Obesity

Heart failure

NA

Liver disease

Unspecified malignant neoplasms of unspecified sites

Systemic lupus erythematosus

Attention deficit hyperactivity disorder

COVID-19

coronary artery disease

Parkinsonism

Type1diabetesmellitus

Macular degeneration

Cardiovascular disease

Lobular carcinoma in situ of breast

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities