• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Aster Tataricus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GAACCTGCGGAAGGATCATTGTCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTATAACAACCATGCCATAATGGGTTGAGCGGCAGTTCGATCCTTGTGGCACACCGTCGATGTGCATCCTTGATGACCCATTCGGGCCTCCTGGTTGTTGCTTCGACGTAACAAAACCCCGGCACGGGATGTGCCAAGGAAATTTAAAGTGAAGAATGGCTCGTTCCATGATGTCCCGTTCGCGGTGCGTTCATGGAGCATGGCTTCTTTGTAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCCACCATTCCTTCCTTCGGGATGCTTGGTTGGGGGCGGATAATGGCCTCCCGTTCCTCACCGAGCGGTTGGCCAAAATAAAAGTCCCCTTTGATGGATGCACGACTAGTGGTGGTTGACAAAACCCGGTATTGTGTCGTGTGTCATGTCGAAAGGGTGCATCTTAGTAGACCCAACGCGTTGTCACGAAGCAACGCATCGA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO28688
Plant Latin Name: Aster Tataricus
Taxonomy Genus: Aster
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 588669
Plant-of-the-World-Online: 182425-1

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM


Medicinal Functions:

Antibacterial; Antifungal; Antitussive; Cancer; Expectorant

Geographical Distribution

South Africa; Mongolia; United States; Germany; Japan; China; South Korea; Russia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

140 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


87 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

58 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC99480

Ingredient ID: NPC97490

Ingredient ID: NPC96767

Ingredient ID: NPC95676

Ingredient ID: NPC94304

Ingredient ID: NPC94218

Ingredient ID: NPC94045

Ingredient ID: NPC93213

Ingredient ID: NPC93033

Ingredient ID: NPC92774

Ingredient ID: NPC90787

Ingredient ID: NPC85813

Ingredient ID: NPC85327

Ingredient ID: NPC83578

Ingredient ID: NPC82648

Ingredient ID: NPC82363

Ingredient ID: NPC82046

Ingredient ID: NPC79527

Ingredient ID: NPC78540

Ingredient ID: NPC76145

Ingredient ID: NPC71506

Ingredient ID: NPC67449

Ingredient ID: NPC63941

Ingredient ID: NPC63540

Ingredient ID: NPC62765

Ingredient ID: NPC62086

Ingredient ID: NPC5708

Ingredient ID: NPC52230

Ingredient ID: NPC51748

Ingredient ID: NPC51308

Ingredient ID: NPC4827

Ingredient ID: NPC480424

Ingredient ID: NPC480423

Ingredient ID: NPC480422

Ingredient ID: NPC480421

Ingredient ID: NPC480420

Ingredient ID: NPC480419

Ingredient ID: NPC480418

Ingredient ID: NPC480417

Ingredient ID: NPC42403

Ingredient ID: NPC4125

Ingredient ID: NPC39400

Ingredient ID: NPC3922

Ingredient ID: NPC3649

Ingredient ID: NPC331613

Ingredient ID: NPC320001

Ingredient ID: NPC3190

Ingredient ID: NPC312929

Ingredient ID: NPC312560

Ingredient ID: NPC312391

Ingredient ID: NPC309355

Ingredient ID: NPC307063

Ingredient ID: NPC306616

Ingredient ID: NPC302857

Ingredient ID: NPC299529

Ingredient ID: NPC297517

Ingredient ID: NPC290791

Ingredient ID: NPC282923

Ingredient ID: NPC281994

Ingredient ID: NPC279026

Ingredient ID: NPC278068

Ingredient ID: NPC270074

Ingredient ID: NPC269806

Ingredient ID: NPC268862

Ingredient ID: NPC268292

Ingredient ID: NPC266021

Ingredient ID: NPC266020

Ingredient ID: NPC26583

Ingredient ID: NPC265513

Ingredient ID: NPC261831

Ingredient ID: NPC26065

Ingredient ID: NPC259134

Ingredient ID: NPC258723

Ingredient ID: NPC257522

Ingredient ID: NPC254847

Ingredient ID: NPC251437

Ingredient ID: NPC249018

Ingredient ID: NPC243601

Ingredient ID: NPC233393

Ingredient ID: NPC229419

Ingredient ID: NPC229403

Ingredient ID: NPC225406

Ingredient ID: NPC225284

Ingredient ID: NPC224389

Ingredient ID: NPC223417

Ingredient ID: NPC22084

Ingredient ID: NPC219961

Ingredient ID: NPC219573

Ingredient ID: NPC216630

Ingredient ID: NPC216330

Ingredient ID: NPC215702

Ingredient ID: NPC213322

Ingredient ID: NPC210040

Ingredient ID: NPC20892

Ingredient ID: NPC208382

Ingredient ID: NPC20791

Ingredient ID: NPC207869

Ingredient ID: NPC206380

Ingredient ID: NPC206095

Ingredient ID: NPC202691

Ingredient ID: NPC197378

Ingredient ID: NPC194383

Ingredient ID: NPC189698

Ingredient ID: NPC188238

Ingredient ID: NPC188168

Ingredient ID: NPC184515

Ingredient ID: NPC184049

Ingredient ID: NPC181582

Ingredient ID: NPC180612

Ingredient ID: NPC178859

Ingredient ID: NPC177112

Ingredient ID: NPC175722

Ingredient ID: NPC17458

Ingredient ID: NPC173658

Ingredient ID: NPC170070

Ingredient ID: NPC166894

Ingredient ID: NPC163424

Ingredient ID: NPC162422

Ingredient ID: NPC157923

Ingredient ID: NPC15292

Ingredient ID: NPC149570

Ingredient ID: NPC149203

Ingredient ID: NPC148677

Ingredient ID: NPC143639

Ingredient ID: NPC143252

Ingredient ID: NPC142871

Ingredient ID: NPC142703

Ingredient ID: NPC142187

Ingredient ID: NPC13998

Ingredient ID: NPC138347

Ingredient ID: NPC127447

Ingredient ID: NPC125962

Ingredient ID: NPC122369

Ingredient ID: NPC121270

Ingredient ID: NPC116775

Ingredient ID: NPC114239

Ingredient ID: NPC105707

Ingredient ID: NPC105380

Ingredient ID: NPC100178