• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Cuscuta Australis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTGAACCCTCGCGGTAGAATGACTTGCTAACCTGTACCAATTATTGATTTGAATGTTTGGGTGCCGTTTTTTTGATTTGCCCCCGACGAACAAAAACACCGGCGCAGCAGCGCCAAGGAATATAATAATGAGTGTGCAACCTCGCAGAGCTTGGTTATGCTGCCTGTGAGCTTTGCATCCTTTCAATAAAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGCGAACCATCGAAACTTTGAACGCAAGTTGCGCCTCAAGCCATTCGGTTGAGGGCACGTATGCTTGGGTGTCATGCACACGTCGCCCCCTCCACCCYTTCCGCCGAGTAAGGGGCCTGGAGTTGGGGCGGACATTGGCCTCCCATGGAACATCGCGTCCGTGGTTGGTTAAAAATCTGTCCCGCGGCGATGCACGCCTCGACAAGCGGTGGTTTGAAACGAACCCCTGATCCTTTCCCCCTCGTCCAGAGGAGGAAGGAGGAGAATCTCCATGTCGGGCGCGGCGCTTCGCGACGGGGCACCACGAAAGGCCCGAGAACCTCGA

Click for details-----ITS1

TGTCGACCCTCGCGGTAGAATGACTTGCTAACCTGTACCAATTATTGATTCGAATGTCTGGGTGCCGTCTTTCTGATTTGCCCCAGACGAACAAAAACACCGGCGCAGCAGCGCCAAGGAATATAATAATGAGTGTGCAACCTTGCAGAGCTTGGTTATGTTGCCTGTGAGCTTTGCATCCTTTTAATAAAAA

Click for details-----ITS2

ATTATGTCTCCCCTCTCGTGTGTGGAGTGGGAATAGATCCTGGCCTCCTGGGCCCTTCCTTGGGCGTGGTTGGCCGAAAATGTTGTCCGTGATTTTGTTGATGTCTTGGTGTGCGGTGGATGTGCCATGTGTGCATAGTTGCCAGCCTTGCTCGGCTTCATTGTGGCGTCGGGATCTTATGAAGCTGCCGGTTTTGGCTCTTTGA
Taxonomic Information

Plant ID: NPO28669
Plant Latin Name: Cuscuta Australis
Taxonomy Genus: Cuscuta
Taxonomy Family: Convolvulaceae

Plant External Links:

NCBI TaxonomyDB: 267555
Plant-of-the-World-Online: 267308-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

Turkey; Madagascar; Italy; Bangladesh; Sudan; Hungary; France; Ethiopia; Somalia; Nigeria; Cameroon; Cote d'Ivoire; Turkmenistan; Ghana; Australia; Iran; Algeria; Zambia; China; Kazakhstan; Sierra Leone; Ukraine; Liberia; Tanzania; Indonesia; Morocco; Vietnam; Japan; Switzerland; Russia; Bulgaria; Portugal; South Africa; Tunisia; India; Uzbekistan; Uganda; Greece; Kenya; Taiwan; Tajikistan; Botswana

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

102 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


64 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

41 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95676

Ingredient ID: NPC94304

Ingredient ID: NPC94218

Ingredient ID: NPC94045

Ingredient ID: NPC93033

Ingredient ID: NPC90787

Ingredient ID: NPC87238

Ingredient ID: NPC85813

Ingredient ID: NPC85327

Ingredient ID: NPC82648

Ingredient ID: NPC82363

Ingredient ID: NPC79527

Ingredient ID: NPC78540

Ingredient ID: NPC78263

Ingredient ID: NPC76145

Ingredient ID: NPC62086

Ingredient ID: NPC5708

Ingredient ID: NPC50898

Ingredient ID: NPC4827

Ingredient ID: NPC4125

Ingredient ID: NPC3922

Ingredient ID: NPC3649

Ingredient ID: NPC3190

Ingredient ID: NPC312391

Ingredient ID: NPC309355

Ingredient ID: NPC308404

Ingredient ID: NPC306616

Ingredient ID: NPC302857

Ingredient ID: NPC299529

Ingredient ID: NPC295745

Ingredient ID: NPC281994

Ingredient ID: NPC281457

Ingredient ID: NPC281131

Ingredient ID: NPC278068

Ingredient ID: NPC270074

Ingredient ID: NPC269806

Ingredient ID: NPC268862

Ingredient ID: NPC26583

Ingredient ID: NPC265513

Ingredient ID: NPC26510

Ingredient ID: NPC261831

Ingredient ID: NPC258723

Ingredient ID: NPC257522

Ingredient ID: NPC257272

Ingredient ID: NPC249018

Ingredient ID: NPC243601

Ingredient ID: NPC234153

Ingredient ID: NPC229403

Ingredient ID: NPC225434

Ingredient ID: NPC225406

Ingredient ID: NPC225284

Ingredient ID: NPC223417

Ingredient ID: NPC219573

Ingredient ID: NPC216330

Ingredient ID: NPC215702

Ingredient ID: NPC213322

Ingredient ID: NPC210040

Ingredient ID: NPC20892

Ingredient ID: NPC20791

Ingredient ID: NPC207869

Ingredient ID: NPC206380

Ingredient ID: NPC206095

Ingredient ID: NPC202691

Ingredient ID: NPC197378

Ingredient ID: NPC196745

Ingredient ID: NPC194383

Ingredient ID: NPC194081

Ingredient ID: NPC186047

Ingredient ID: NPC181582

Ingredient ID: NPC180612

Ingredient ID: NPC178859

Ingredient ID: NPC176740

Ingredient ID: NPC17458

Ingredient ID: NPC173658

Ingredient ID: NPC171928

Ingredient ID: NPC170070

Ingredient ID: NPC167976

Ingredient ID: NPC166894

Ingredient ID: NPC163424

Ingredient ID: NPC159611

Ingredient ID: NPC157923

Ingredient ID: NPC15292

Ingredient ID: NPC149570

Ingredient ID: NPC149203

Ingredient ID: NPC148677

Ingredient ID: NPC142871

Ingredient ID: NPC142703

Ingredient ID: NPC135391

Ingredient ID: NPC133671

Ingredient ID: NPC127447

Ingredient ID: NPC125962

Ingredient ID: NPC125062

Ingredient ID: NPC124359

Ingredient ID: NPC121270

Ingredient ID: NPC117529

Ingredient ID: NPC116775

Ingredient ID: NPC114239

Ingredient ID: NPC110942

Ingredient ID: NPC1075

Ingredient ID: NPC105380

Ingredient ID: NPC100223

Ingredient ID: NPC100178