• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Isodon Rubescens


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGACCGCGAACACGTTTCTAACGCCATCCCCCGCCGCAGCGCGCGCACTCGTGCCGCGCAGCGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTTAAATTTAGCGTCGGTCCCGCGCCGCATCCCGTTCGCGGGCCGTGCGGTGTGGAACGGGCGTCTATAGAATGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCCCCCCACCACTCTGGCGAGGGGGGGCGGATATTGGCCTCCCGTGCGCCTCGGTGTGCGGCCGGCCCAAATGCGATCCCCCGGCGACTCGCGTCGCGACAAGTGGTGGTTGAACATCTCAATCTCGCGTCTCGTCGTGCCGCCGAGCCGTCCGTGGTGATCCGAACGATGACCCAACGGAGCTTGCTCCTTCGA

Click for details-----ITS1

TCGAAACCTGCAAAGCAGACCGCGAACACGTTTCTAACGCCATCCCCCGCCGTAGCGCGCGCACTCGTGCCGTGCGGCGTGCGGGCTAACGAACCCCGGCGCGGAACGCGCCAAGGAAAACTTAAATTTAGCGTCGGTCCCGCCCCGCATCCCGTTCGCGGGCCGTGCGGTGCGGAACGGGCGTCTATAGAATGTCATAA

Click for details-----ITS2

ATCGCGTCGCTCCCCCCCGCCACTCTGGCGAGGGGGGCGGATATTGGCCTCCCGTGTGCCTCGGCGTGCGGCCGGCCCAAATGCGATACCCCGGCGACTCGCGTCGCGACAAGTGGTGGTTGAACATCTCAATCTCGTGTCTCGTCGTGCTGCCGAGCCGTCCGTGGTGATCCGAATGATGACCCAACGGAGCTTGCTCCTTCGA
Taxonomic Information

Plant ID: NPO28626
Plant Latin Name: Isodon Rubescens
Taxonomy Genus: Isodon
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 587669
Plant-of-the-World-Online: 915158-1

Used in Medicines

Unknown.

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

178 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


117 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

75 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99244

Ingredient ID: NPC9609

Ingredient ID: NPC95460

Ingredient ID: NPC94788

Ingredient ID: NPC94141

Ingredient ID: NPC93362

Ingredient ID: NPC89944

Ingredient ID: NPC89860

Ingredient ID: NPC88566

Ingredient ID: NPC87517

Ingredient ID: NPC8463

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC75657

Ingredient ID: NPC72695

Ingredient ID: NPC69486

Ingredient ID: NPC68932

Ingredient ID: NPC68782

Ingredient ID: NPC67222

Ingredient ID: NPC66868

Ingredient ID: NPC63126

Ingredient ID: NPC61198

Ingredient ID: NPC61

Ingredient ID: NPC59650

Ingredient ID: NPC58716

Ingredient ID: NPC57443

Ingredient ID: NPC55973

Ingredient ID: NPC54172

Ingredient ID: NPC53206

Ingredient ID: NPC52005

Ingredient ID: NPC51895

Ingredient ID: NPC51700

Ingredient ID: NPC50593

Ingredient ID: NPC49151

Ingredient ID: NPC49098

Ingredient ID: NPC477352

Ingredient ID: NPC47489

Ingredient ID: NPC45367

Ingredient ID: NPC44931

Ingredient ID: NPC44272

Ingredient ID: NPC4373

Ingredient ID: NPC42149

Ingredient ID: NPC41979

Ingredient ID: NPC41494

Ingredient ID: NPC39683

Ingredient ID: NPC39365

Ingredient ID: NPC38884

Ingredient ID: NPC37859

Ingredient ID: NPC35114

Ingredient ID: NPC34764

Ingredient ID: NPC33511

Ingredient ID: NPC32626

Ingredient ID: NPC312929

Ingredient ID: NPC311866

Ingredient ID: NPC308289

Ingredient ID: NPC303729

Ingredient ID: NPC302857

Ingredient ID: NPC302778

Ingredient ID: NPC302426

Ingredient ID: NPC301627

Ingredient ID: NPC299089

Ingredient ID: NPC29839

Ingredient ID: NPC298093

Ingredient ID: NPC297268

Ingredient ID: NPC294902

Ingredient ID: NPC293588

Ingredient ID: NPC291728

Ingredient ID: NPC288537

Ingredient ID: NPC287387

Ingredient ID: NPC287331

Ingredient ID: NPC286167

Ingredient ID: NPC285061

Ingredient ID: NPC284237

Ingredient ID: NPC283255

Ingredient ID: NPC282116

Ingredient ID: NPC279525

Ingredient ID: NPC277074

Ingredient ID: NPC274499

Ingredient ID: NPC274384

Ingredient ID: NPC273021

Ingredient ID: NPC26937

Ingredient ID: NPC264711

Ingredient ID: NPC263251

Ingredient ID: NPC262505

Ingredient ID: NPC261947

Ingredient ID: NPC258104

Ingredient ID: NPC25581

Ingredient ID: NPC255662

Ingredient ID: NPC255580

Ingredient ID: NPC255497

Ingredient ID: NPC249616

Ingredient ID: NPC248981

Ingredient ID: NPC241579

Ingredient ID: NPC241235

Ingredient ID: NPC237506

Ingredient ID: NPC236716

Ingredient ID: NPC233972

Ingredient ID: NPC224522

Ingredient ID: NPC224242

Ingredient ID: NPC22110

Ingredient ID: NPC220518

Ingredient ID: NPC217052

Ingredient ID: NPC216440

Ingredient ID: NPC21534

Ingredient ID: NPC215317

Ingredient ID: NPC212591

Ingredient ID: NPC212551

Ingredient ID: NPC211820

Ingredient ID: NPC210003

Ingredient ID: NPC209298

Ingredient ID: NPC20836

Ingredient ID: NPC20505

Ingredient ID: NPC204443

Ingredient ID: NPC204204

Ingredient ID: NPC204120

Ingredient ID: NPC203891

Ingredient ID: NPC202245

Ingredient ID: NPC201136

Ingredient ID: NPC196209

Ingredient ID: NPC192978

Ingredient ID: NPC189663

Ingredient ID: NPC189142

Ingredient ID: NPC187206

Ingredient ID: NPC186653

Ingredient ID: NPC186100

Ingredient ID: NPC185991

Ingredient ID: NPC183401

Ingredient ID: NPC182896

Ingredient ID: NPC18284

Ingredient ID: NPC182277

Ingredient ID: NPC182095

Ingredient ID: NPC181465

Ingredient ID: NPC18074

Ingredient ID: NPC177701

Ingredient ID: NPC1769

Ingredient ID: NPC176740

Ingredient ID: NPC176728

Ingredient ID: NPC176300

Ingredient ID: NPC169232

Ingredient ID: NPC168653

Ingredient ID: NPC167976

Ingredient ID: NPC167932

Ingredient ID: NPC167459

Ingredient ID: NPC166641

Ingredient ID: NPC165287

Ingredient ID: NPC16209

Ingredient ID: NPC160951

Ingredient ID: NPC156222

Ingredient ID: NPC153701

Ingredient ID: NPC153234

Ingredient ID: NPC145606

Ingredient ID: NPC144557

Ingredient ID: NPC144486

Ingredient ID: NPC142415

Ingredient ID: NPC140182

Ingredient ID: NPC13787

Ingredient ID: NPC136129

Ingredient ID: NPC136014

Ingredient ID: NPC133852

Ingredient ID: NPC132921

Ingredient ID: NPC12529

Ingredient ID: NPC125062

Ingredient ID: NPC123928

Ingredient ID: NPC123663

Ingredient ID: NPC122811

Ingredient ID: NPC118880

Ingredient ID: NPC118847

Ingredient ID: NPC117193

Ingredient ID: NPC115275

Ingredient ID: NPC11433

Ingredient ID: NPC114103

Ingredient ID: NPC113055

Ingredient ID: NPC110070

Ingredient ID: NPC109594

Ingredient ID: NPC109024

Ingredient ID: NPC1075

Ingredient ID: NPC103167

Ingredient ID: NPC101692