• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hypecoum Leptocarpum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCAGAGAACGACCCGGACTTGTCACCACGCACGGGGGGGCCGCACCCTTCGGTACGACACCCCCGGTCCGTGGGGGATCTCGATCCTCCGGGGGAAACAATACCAACCCCGGCGCGGAAAGCGCCAAGGAAACATACAACGGAAGCTGCGAACCCTCCGCGAGGGGACGCGTCCGAACTTTTGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTACGCCGTCAGGCCGAGGGACGCCTGCCTGGGCGTCACGCACATGAGTCGCACCCCACGCCTTTCGGGCGCGAGGAGCGGAAGTTGGCCCCCCGTGCTACAACAGCGCGGTCGGCCTAAACATAGGCCTATGGCTGGCAGCGTCACGATCTGTGGTGGTCGTTGGTAACCCTCGCCAAACCGGATCGCGTGTCCTGCCCAGCTGCTAAGGCCATCGGGACCCTTTAGGGCCGCTCCGGCGGCATCCACTCT

Click for details-----ITS1

TCGAAACCTGCCCAGAGAACGACCCGGACTTGTCACCACGCACGGGGGGGCCGCACCCTTCGGTACGACACCCCCGGTCCGTGGGGGATCTCGATCCTCCGGGGGAAACAATACCAACCCCGGCGCGGAAAGCGCCAAGGAAACATACAACGGAAGCTGCGAACCCTCCGCGAGGGGACGCGTCCGAACTTTTGAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO28612
Plant Latin Name: Hypecoum Leptocarpum
Taxonomy Genus: Hypecoum
Taxonomy Family: Papaveraceae

Plant External Links:

NCBI TaxonomyDB: 72180
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

12 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


12 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

5 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC51283

Ingredient ID: NPC48412

Ingredient ID: NPC314828

Ingredient ID: NPC308267

Ingredient ID: NPC307065

Ingredient ID: NPC300507

Ingredient ID: NPC300365

Ingredient ID: NPC23614

Ingredient ID: NPC174200

Ingredient ID: NPC171409

Ingredient ID: NPC143329

Ingredient ID: NPC100079