• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Olea Europaea


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CATTGTCGAAACCCGCGAGGCAGACCCGCGAACCCGTTCCACGACACGCGCGGGAGGACGGCGCGGGCGCGACCGAAGGGTCGCCCCGGGTCGGAGACCCGCTCCGTCGACGAGCGCGCTCGCGCGCCCGTCGCACGGCCCAACGAACCCCGGCGCGAAAAGCGTCAAGGAAAACTCAAGGCGTCGCTCGCCCCCCGGTGCCCCGTTCGCGGTCGGCACCTCGGGGACAGGGCGTGCATCGAAATCGAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCATCGTGCCGAGGGCACGTCTGCCTGGGCGTCACGCACATCGTCGCCCTCCGCCCGATCAAGGATCGCGGGCGCCGGGTCGGAAACTGGCCTCCCGTGCGCGTCCGCGCGCGGCCGGCCCAAATGCGATTCGGCGTCGACGCGAGTCGCGGCAATTGGTGGTTGAGGACCTCAACTCGCGCGTTGTCGCGCACGACCGCGTCGTTCGGCCGGGATGCCCCGGACCCCGAAGGTGCCGCGCGCACCTCGACTGCG

Click for details-----ITS1

TGCGGAAGGATCATTGTCGAAACCCGCGAGGCAGACCCGCGAACCCGTTCCACGACACGCGCGGGAGGACGGCGCGGGCGCGATCGAAGGGTCGCCCCGGGTCGGAGACCCGCTCCGTCGACGAGCGCGCTCGCGCGCCCGTCGCACGGCCCAACGAACCCCGGCGCGAAAAGCGTCAAGGAAAACTCAAGGCGTCGCTCGCCCCCCGGTGCCCCGTTCGCGGTCGGCACCTCGGGGACAGGGCGTGCATCGAAATCGAAA

Click for details-----ITS2

ACATCGTCGCCCTCCGCCCCCGATTAAGGATCGCGGGCGCCGGGCCGGAAACTGGCCTCCCGTGCGCGTCCGCGCGCGGCCGGCCCAAATGCGATTCGGCGTCGACGCGAGTCGCGGCAATTGGTGGTTGAGGACCTCAACTCGCGCGTTGTCGCGCTACGACCGCGTCGTTCGGCCGGGGTGCCCCTACGAATTCCTGGTCCGGTGAAGGGTTCGTACGAATTCATGGTCCGGGGAAGAGTTCGTACGAATTCAAGGTCCGG
Taxonomic Information

Plant ID: NPO28608
Plant Latin Name: Olea Europaea
Taxonomy Genus: Olea
Taxonomy Family: Oleaceae

Plant External Links:

NCBI TaxonomyDB: 4146
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; China; Iraq; Lebanon; India

Traditional Medicine System:
Indian Folk; TCM; Unani; Siddha


Medicinal Functions:

Antipruritic; Antiseptic; Astringent; Bach; Cholagogue; Demulcent; Emollient; Febrifuge; Hypoglycaemic; Laxative; Sedative

Geographical Distribution

Lebanon; India; Turkey; Iraq; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

152 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


102 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

85 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC93888

Ingredient ID: NPC85813

Ingredient ID: NPC84319

Ingredient ID: NPC83970

Ingredient ID: NPC83723

Ingredient ID: NPC81010

Ingredient ID: NPC806

Ingredient ID: NPC73288

Ingredient ID: NPC70744

Ingredient ID: NPC64850

Ingredient ID: NPC62045

Ingredient ID: NPC59650

Ingredient ID: NPC58279

Ingredient ID: NPC55412

Ingredient ID: NPC52472

Ingredient ID: NPC50898

Ingredient ID: NPC490288

Ingredient ID: NPC490248

Ingredient ID: NPC490225

Ingredient ID: NPC490221

Ingredient ID: NPC490220

Ingredient ID: NPC489922

Ingredient ID: NPC489921

Ingredient ID: NPC489917

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC489899

Ingredient ID: NPC48623

Ingredient ID: NPC484296

Ingredient ID: NPC469269

Ingredient ID: NPC4665

Ingredient ID: NPC424

Ingredient ID: NPC39426

Ingredient ID: NPC39142

Ingredient ID: NPC3639

Ingredient ID: NPC34241

Ingredient ID: NPC33667

Ingredient ID: NPC328447

Ingredient ID: NPC327986

Ingredient ID: NPC327662

Ingredient ID: NPC324200

Ingredient ID: NPC324051

Ingredient ID: NPC322773

Ingredient ID: NPC318998

Ingredient ID: NPC317120

Ingredient ID: NPC317046

Ingredient ID: NPC313981

Ingredient ID: NPC31338

Ingredient ID: NPC310816

Ingredient ID: NPC308599

Ingredient ID: NPC306975

Ingredient ID: NPC304927

Ingredient ID: NPC300326

Ingredient ID: NPC300017

Ingredient ID: NPC299825

Ingredient ID: NPC29883

Ingredient ID: NPC297180

Ingredient ID: NPC296643

Ingredient ID: NPC294941

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293356

Ingredient ID: NPC292129

Ingredient ID: NPC289774

Ingredient ID: NPC287478

Ingredient ID: NPC284856

Ingredient ID: NPC281686

Ingredient ID: NPC281020

Ingredient ID: NPC279121

Ingredient ID: NPC275175

Ingredient ID: NPC274455

Ingredient ID: NPC272614

Ingredient ID: NPC269919

Ingredient ID: NPC266113

Ingredient ID: NPC2660

Ingredient ID: NPC265305

Ingredient ID: NPC265148

Ingredient ID: NPC264558

Ingredient ID: NPC261831

Ingredient ID: NPC260196

Ingredient ID: NPC257653

Ingredient ID: NPC257182

Ingredient ID: NPC251029

Ingredient ID: NPC248996

Ingredient ID: NPC246679

Ingredient ID: NPC245561

Ingredient ID: NPC242580

Ingredient ID: NPC241089

Ingredient ID: NPC23962

Ingredient ID: NPC237812

Ingredient ID: NPC235767

Ingredient ID: NPC234853

Ingredient ID: NPC232954

Ingredient ID: NPC231360

Ingredient ID: NPC230702

Ingredient ID: NPC230519

Ingredient ID: NPC230301

Ingredient ID: NPC226453

Ingredient ID: NPC225710

Ingredient ID: NPC223004

Ingredient ID: NPC222084

Ingredient ID: NPC210003

Ingredient ID: NPC208793

Ingredient ID: NPC205084

Ingredient ID: NPC204848

Ingredient ID: NPC203719

Ingredient ID: NPC201284

Ingredient ID: NPC197598

Ingredient ID: NPC196690

Ingredient ID: NPC191306

Ingredient ID: NPC189142

Ingredient ID: NPC187770

Ingredient ID: NPC183388

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC174249

Ingredient ID: NPC174246

Ingredient ID: NPC173637

Ingredient ID: NPC171495

Ingredient ID: NPC171280

Ingredient ID: NPC171195

Ingredient ID: NPC168579

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC165114

Ingredient ID: NPC159464

Ingredient ID: NPC158079

Ingredient ID: NPC156018

Ingredient ID: NPC155263

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC150148

Ingredient ID: NPC149602

Ingredient ID: NPC147597

Ingredient ID: NPC144939

Ingredient ID: NPC142415

Ingredient ID: NPC140734

Ingredient ID: NPC137958

Ingredient ID: NPC137537

Ingredient ID: NPC136014

Ingredient ID: NPC132888

Ingredient ID: NPC130700

Ingredient ID: NPC126681

Ingredient ID: NPC12278

Ingredient ID: NPC120649

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC112866

Ingredient ID: NPC111888

Ingredient ID: NPC111089

Ingredient ID: NPC110899

Ingredient ID: NPC101475