• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Oroxylum Indicum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GAAGGATCATTGTCGAATCCTACAAAGTAGACCGCGAACCAGTTCTCGATCACGCGGGGCAAGCGATGCGGGGGCGACTCCCGTCGCTGCCCATCCCGCCGGTGCAAGCGCGAACTTGCACCGTGCGGGCTTAACCAAAACCGGCGCGGCATGCGCCAAGGAGTACGGAACGAAGCGCCGGCCTCTCCCATCCCGTTCGCGGGGTGCACGGGAGGGGAACGGCCTTCTCTTGAAATGTCGTAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCAAGGGCACGTCTGCCTGGGCGTCTTGCATCGCGTCGCCCCCACTCTCCCCGGCCCAAGCGTGCGGGAGATACGGGGCGGAAATTGGCAGCCCGTGCGCCCCCGCGCGCGGCCGGCCCAAATTCTCGCTCGCGACGATGCGCGTCACTGCCAGTGGTGGTTGAACATCAACTCTCATTCCGCAGTGCGACGTGGCATCGCCAGCTCGCGAACCGTCACAGACCCTACGGGCTCCTGCGCGCGCGCACGATGCCCCCGACCGCGACCCCAGGTCAGGCG

Click for details-----ITS1

GAAGGATCATTGTCGAATCCTACAAAGTAGACCGCGAACCAGTTCTCGATCACGCGGGGCAAGCGATGCGGGGGCGACTCCCGTCGCTGCCCATCCCGCCGGTGCAAGCGCGAACTTGCACCGTGCGGGCTTAACCAAAACCGGCGCGGCATGCGCCAAGGAGTACGGAACGAAGCGCCGGCCTCTCCCATCCCGTTCGCGGGGTGCACGGGAGGGGAACGGCCTTCTCTTGAAATGTCGTAA

Click for details-----ITS2

ATCGCGTCGCCCCCACTCTCCCCGGCCCAAGCGTGCGGGAGATACGGGGCGGAAATTGGCAGCCCGTGCGCCCCCGCGCGCGGCCGGCCCAAATTCTCGCTCGCGACGATGCGCGTCACTGCCAGTGGTGGTTGAACATCAACTCTCATTCCGCAGTGCGACGTGGCATCGCCAGCTCGCGAACCGTCACAGACCCTACGGGCTCCTGCGCGCGCGCACGATGCCCCCGACCGCGACCCCAGGTCAGGCG
Taxonomic Information

Plant ID: NPO28574
Plant Latin Name: Oroxylum Indicum
Taxonomy Genus: Oroxylum
Taxonomy Family: Bignoniaceae

Plant External Links:

NCBI TaxonomyDB: 83951
Plant-of-the-World-Online: 110175-1

Used in Medicines

Country/Region:
Thailand; Indonesia; India; China; Laos

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM

Geographical Distribution

Nepal; Bangladesh; Myanmar; Philippines; Indonesia; India; Cambodia; Trinidad and Tobago; Vietnam; China; Laos; Sri Lanka; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

139 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


55 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

46 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97556

Ingredient ID: NPC97291

Ingredient ID: NPC95906

Ingredient ID: NPC87582

Ingredient ID: NPC85925

Ingredient ID: NPC82800

Ingredient ID: NPC78540

Ingredient ID: NPC70622

Ingredient ID: NPC70147

Ingredient ID: NPC6984

Ingredient ID: NPC69432

Ingredient ID: NPC67056

Ingredient ID: NPC65453

Ingredient ID: NPC62559

Ingredient ID: NPC60291

Ingredient ID: NPC54383

Ingredient ID: NPC5427

Ingredient ID: NPC50898

Ingredient ID: NPC476368

Ingredient ID: NPC45618

Ingredient ID: NPC44957

Ingredient ID: NPC44905

Ingredient ID: NPC43851

Ingredient ID: NPC43212

Ingredient ID: NPC42605

Ingredient ID: NPC4152

Ingredient ID: NPC41315

Ingredient ID: NPC37832

Ingredient ID: NPC36395

Ingredient ID: NPC36362

Ingredient ID: NPC326182

Ingredient ID: NPC32298

Ingredient ID: NPC32163

Ingredient ID: NPC312984

Ingredient ID: NPC305900

Ingredient ID: NPC304032

Ingredient ID: NPC303644

Ingredient ID: NPC303422

Ingredient ID: NPC299536

Ingredient ID: NPC29844

Ingredient ID: NPC296496

Ingredient ID: NPC296073

Ingredient ID: NPC294419

Ingredient ID: NPC29353

Ingredient ID: NPC29341

Ingredient ID: NPC293183

Ingredient ID: NPC293160

Ingredient ID: NPC292489

Ingredient ID: NPC2918

Ingredient ID: NPC291789

Ingredient ID: NPC290613

Ingredient ID: NPC290015

Ingredient ID: NPC29

Ingredient ID: NPC288580

Ingredient ID: NPC279121

Ingredient ID: NPC277467

Ingredient ID: NPC271083

Ingredient ID: NPC268826

Ingredient ID: NPC265844

Ingredient ID: NPC265800

Ingredient ID: NPC260916

Ingredient ID: NPC256853

Ingredient ID: NPC255106

Ingredient ID: NPC254633

Ingredient ID: NPC248573

Ingredient ID: NPC243728

Ingredient ID: NPC243670

Ingredient ID: NPC243083

Ingredient ID: NPC239312

Ingredient ID: NPC237685

Ingredient ID: NPC237435

Ingredient ID: NPC236824

Ingredient ID: NPC236709

Ingredient ID: NPC232562

Ingredient ID: NPC230301

Ingredient ID: NPC228395

Ingredient ID: NPC226284

Ingredient ID: NPC222847

Ingredient ID: NPC222830

Ingredient ID: NPC219553

Ingredient ID: NPC218017

Ingredient ID: NPC215206

Ingredient ID: NPC214610

Ingredient ID: NPC213368

Ingredient ID: NPC211965

Ingredient ID: NPC20791

Ingredient ID: NPC201551

Ingredient ID: NPC199478

Ingredient ID: NPC196776

Ingredient ID: NPC196069

Ingredient ID: NPC192657

Ingredient ID: NPC192638

Ingredient ID: NPC191472

Ingredient ID: NPC190364

Ingredient ID: NPC189126

Ingredient ID: NPC183953

Ingredient ID: NPC17778

Ingredient ID: NPC175216

Ingredient ID: NPC17454

Ingredient ID: NPC169718

Ingredient ID: NPC169454

Ingredient ID: NPC168957

Ingredient ID: NPC168206

Ingredient ID: NPC161617

Ingredient ID: NPC161571

Ingredient ID: NPC160573

Ingredient ID: NPC157912

Ingredient ID: NPC156461

Ingredient ID: NPC156353

Ingredient ID: NPC155185

Ingredient ID: NPC154288

Ingredient ID: NPC152156

Ingredient ID: NPC150919

Ingredient ID: NPC147028

Ingredient ID: NPC143011

Ingredient ID: NPC13768

Ingredient ID: NPC13470

Ingredient ID: NPC133926

Ingredient ID: NPC131624

Ingredient ID: NPC130230

Ingredient ID: NPC127447

Ingredient ID: NPC127153

Ingredient ID: NPC125589

Ingredient ID: NPC123587

Ingredient ID: NPC121745

Ingredient ID: NPC121319

Ingredient ID: NPC121205

Ingredient ID: NPC120464

Ingredient ID: NPC118478

Ingredient ID: NPC116775

Ingredient ID: NPC114942

Ingredient ID: NPC113864

Ingredient ID: NPC113773

Ingredient ID: NPC110899

Ingredient ID: NPC110661

Ingredient ID: NPC107066

Ingredient ID: NPC101508

Ingredient ID: NPC100634

Ingredient ID: NPC100340