• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hippeastrum Aulicum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TAGAGTCCCGAACGGACGATCGCGAACTCGTAGAGCAACCGTAGTGGGCGGTAGGGGGCGGCGATCGCCGTCTGCCTTCGCCTGCTTGGGTGCCCCAGCCGTCGCTGCCCCGCACGCCCTGCGGGAGGAGAGACGGGAACAATTTCCGGTGCCTTGCGCGCCAAGGAGCAGCCCCGTTTGGAGAGCGTAGCGTGCGGCAACCTTAGCGCTGCAGCACGTGAGGCGATCCTGGTACGTCTAACCTGCA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO28568
Plant Latin Name: Hippeastrum Aulicum
Taxonomy Genus: Hippeastrum
Taxonomy Family: Amaryllidaceae

Plant External Links:

NCBI TaxonomyDB: 1234390
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

43 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


37 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

21 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95443

Ingredient ID: NPC91858

Ingredient ID: NPC88566

Ingredient ID: NPC87828

Ingredient ID: NPC83831

Ingredient ID: NPC76145

Ingredient ID: NPC70208

Ingredient ID: NPC62765

Ingredient ID: NPC62086

Ingredient ID: NPC3649

Ingredient ID: NPC35543

Ingredient ID: NPC35519

Ingredient ID: NPC312391

Ingredient ID: NPC30991

Ingredient ID: NPC309399

Ingredient ID: NPC299529

Ingredient ID: NPC283655

Ingredient ID: NPC2605

Ingredient ID: NPC246581

Ingredient ID: NPC243083

Ingredient ID: NPC225284

Ingredient ID: NPC219436

Ingredient ID: NPC216610

Ingredient ID: NPC205866

Ingredient ID: NPC202691

Ingredient ID: NPC188238

Ingredient ID: NPC18816

Ingredient ID: NPC172963

Ingredient ID: NPC170303

Ingredient ID: NPC161923

Ingredient ID: NPC159362

Ingredient ID: NPC150424

Ingredient ID: NPC149960

Ingredient ID: NPC14166

Ingredient ID: NPC139717

Ingredient ID: NPC139546

Ingredient ID: NPC138113

Ingredient ID: NPC133253

Ingredient ID: NPC128248

Ingredient ID: NPC123290

Ingredient ID: NPC118426

Ingredient ID: NPC114239

Ingredient ID: NPC109854