• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Phyllanthus Emblica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TAGGGGGGGCCTGCGGAAGGATCATTGTCAAAACCTTGTACTGGTATGACCCGCGAACAAGTTTAGTCACTGCGGATGGTGCCTTGTGCACTTGAAGCCAGGCCACGCGGGGTGCTATGCTCCTTGCGGAGGCCACATAAACCAACCCCGGCGCGGAATGCGCCAAGGAAAACGAATCTAAAAGAGAGAACTCTACGTTCGCCTCGGAAACGATGTGTGCATGTAGTTGAATCTCCTTTCATAACCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCTTCGGGTCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCTCCCTCACTTCCCTCTTGTGGGGCTCGTGAATTGGGAGCGGAAAATGGCTTCCCATAAACTTCGAGATTGTGGTTGGCCCAAACATGAGACCAGGTCGGTCAGTGCCGTGGCATTCGGTGGTTGAAAATACCCTAAAAACGCCTCGTTCATTTGGCCGAACCAGCACGAATCTCAACGACCCTCTATGTATCCGACGCGACCCCAGGTCAGGCGCTACCCCTTG

Click for details-----ITS1

GGGTGAACATGTGGAAGGATCATTGTCAAAACCTTGTACTGGTATGACCCGCGAACAAGTTTAGTCACTGCGGATGGTGCCTTGTGCACTTGAAGCCAGGCCACGCGGGGTGCTATGCTCCTTGCGGAGGCCACATAAACCAACCCCGGCGCGGAATGCGCCAAGGAAAACGAATCTAAAAGAGAGAACTCTACGTTCGCCTCGGAAACGATGTGTGCATGTAGTTGAATCTCCTTTCATAACCAAAA

Click for details-----ITS2

AACGTCGCTCCCTCACTTCCCTCTTGTGGGGCTCGTGAATTGGGAGCGGAAAATGGCTTCCCATAAACTTCGAGATTGTGGTTGGCCCAAACATGAGACCAGGTCGGTCAGTGCCGTGGCATTCGGTGGTTGAAAATACCCTAAAAACGCCTCGTTCATTTGGCCGAACCAGCACGAATCTCAACGACCCTCTATGTATCCGACGCGACCCCGGGTCAGGCGGGATTACCCGC
Taxonomic Information

Plant ID: NPO28450
Plant Latin Name: Phyllanthus Emblica
Taxonomy Genus: Phyllanthus
Taxonomy Family: Phyllanthaceae

Plant External Links:

NCBI TaxonomyDB: 296036
Plant-of-the-World-Online: 353838-1

Used in Medicines

Country/Region:
Philippines; Indonesia; India; Malaysia; Vietnam; China; Laos; Sri Lanka; Thailand

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM

Geographical Distribution

Pakistan; Bangladesh; Myanmar; Cuba; Philippines; Indonesia; India; Cambodia; Mauritius; Malaysia; Trinidad and Tobago; Vietnam; China; Laos; Sri Lanka; Thailand; Taiwan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

210 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


101 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

95 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98925

Ingredient ID: NPC98616

Ingredient ID: NPC98301

Ingredient ID: NPC96630

Ingredient ID: NPC96145

Ingredient ID: NPC9331

Ingredient ID: NPC92117

Ingredient ID: NPC90566

Ingredient ID: NPC89069

Ingredient ID: NPC8851

Ingredient ID: NPC86419

Ingredient ID: NPC86136

Ingredient ID: NPC85040

Ingredient ID: NPC82648

Ingredient ID: NPC80749

Ingredient ID: NPC7839

Ingredient ID: NPC76264

Ingredient ID: NPC76145

Ingredient ID: NPC75158

Ingredient ID: NPC7314

Ingredient ID: NPC66078

Ingredient ID: NPC64103

Ingredient ID: NPC62290

Ingredient ID: NPC61860

Ingredient ID: NPC57544

Ingredient ID: NPC56505

Ingredient ID: NPC54264

Ingredient ID: NPC50898

Ingredient ID: NPC49362

Ingredient ID: NPC477737

Ingredient ID: NPC477736

Ingredient ID: NPC477735

Ingredient ID: NPC47272

Ingredient ID: NPC46248

Ingredient ID: NPC4594

Ingredient ID: NPC44751

Ingredient ID: NPC43918

Ingredient ID: NPC40249

Ingredient ID: NPC3862

Ingredient ID: NPC37366

Ingredient ID: NPC36408

Ingredient ID: NPC34764

Ingredient ID: NPC34565

Ingredient ID: NPC34381

Ingredient ID: NPC33909

Ingredient ID: NPC3357

Ingredient ID: NPC326775

Ingredient ID: NPC326183

Ingredient ID: NPC326113

Ingredient ID: NPC32441

Ingredient ID: NPC322171

Ingredient ID: NPC31799

Ingredient ID: NPC311532

Ingredient ID: NPC311485

Ingredient ID: NPC309779

Ingredient ID: NPC309330

Ingredient ID: NPC308456

Ingredient ID: NPC308218

Ingredient ID: NPC304245

Ingredient ID: NPC29765

Ingredient ID: NPC297184

Ingredient ID: NPC295442

Ingredient ID: NPC294643

Ingredient ID: NPC294136

Ingredient ID: NPC29310

Ingredient ID: NPC292792

Ingredient ID: NPC285369

Ingredient ID: NPC284731

Ingredient ID: NPC283655

Ingredient ID: NPC282097

Ingredient ID: NPC28081

Ingredient ID: NPC280501

Ingredient ID: NPC280436

Ingredient ID: NPC279121

Ingredient ID: NPC276552

Ingredient ID: NPC275462

Ingredient ID: NPC272998

Ingredient ID: NPC272185

Ingredient ID: NPC271321

Ingredient ID: NPC270620

Ingredient ID: NPC268342

Ingredient ID: NPC267842

Ingredient ID: NPC266457

Ingredient ID: NPC266274

Ingredient ID: NPC265800

Ingredient ID: NPC264145

Ingredient ID: NPC262505

Ingredient ID: NPC262094

Ingredient ID: NPC262027

Ingredient ID: NPC260916

Ingredient ID: NPC260115

Ingredient ID: NPC25986

Ingredient ID: NPC259512

Ingredient ID: NPC257756

Ingredient ID: NPC257124

Ingredient ID: NPC25669

Ingredient ID: NPC255042

Ingredient ID: NPC249980

Ingredient ID: NPC249801

Ingredient ID: NPC24923

Ingredient ID: NPC247629

Ingredient ID: NPC246705

Ingredient ID: NPC246162

Ingredient ID: NPC2458

Ingredient ID: NPC238122

Ingredient ID: NPC234510

Ingredient ID: NPC234113

Ingredient ID: NPC232680

Ingredient ID: NPC232514

Ingredient ID: NPC231770

Ingredient ID: NPC231738

Ingredient ID: NPC230573

Ingredient ID: NPC225783

Ingredient ID: NPC225710

Ingredient ID: NPC225346

Ingredient ID: NPC224579

Ingredient ID: NPC220825

Ingredient ID: NPC219876

Ingredient ID: NPC218109

Ingredient ID: NPC217545

Ingredient ID: NPC216630

Ingredient ID: NPC21608

Ingredient ID: NPC210465

Ingredient ID: NPC209275

Ingredient ID: NPC208936

Ingredient ID: NPC208527

Ingredient ID: NPC20791

Ingredient ID: NPC207383

Ingredient ID: NPC206800

Ingredient ID: NPC206752

Ingredient ID: NPC203904

Ingredient ID: NPC203100

Ingredient ID: NPC201814

Ingredient ID: NPC199727

Ingredient ID: NPC197977

Ingredient ID: NPC197396

Ingredient ID: NPC197356

Ingredient ID: NPC196612

Ingredient ID: NPC196490

Ingredient ID: NPC192402

Ingredient ID: NPC192158

Ingredient ID: NPC191556

Ingredient ID: NPC190810

Ingredient ID: NPC19044

Ingredient ID: NPC189036

Ingredient ID: NPC187770

Ingredient ID: NPC187432

Ingredient ID: NPC184993

Ingredient ID: NPC182840

Ingredient ID: NPC180684

Ingredient ID: NPC178223

Ingredient ID: NPC178134

Ingredient ID: NPC177234

Ingredient ID: NPC176740

Ingredient ID: NPC173996

Ingredient ID: NPC173872

Ingredient ID: NPC173638

Ingredient ID: NPC172262

Ingredient ID: NPC171280

Ingredient ID: NPC170203

Ingredient ID: NPC169073

Ingredient ID: NPC167571

Ingredient ID: NPC166894

Ingredient ID: NPC164599

Ingredient ID: NPC161555

Ingredient ID: NPC161420

Ingredient ID: NPC16080

Ingredient ID: NPC160789

Ingredient ID: NPC159106

Ingredient ID: NPC156654

Ingredient ID: NPC153439

Ingredient ID: NPC150438

Ingredient ID: NPC149300

Ingredient ID: NPC149018

Ingredient ID: NPC147714

Ingredient ID: NPC14682

Ingredient ID: NPC143799

Ingredient ID: NPC143005

Ingredient ID: NPC142291

Ingredient ID: NPC141509

Ingredient ID: NPC14030

Ingredient ID: NPC139131

Ingredient ID: NPC138113

Ingredient ID: NPC135602

Ingredient ID: NPC132778

Ingredient ID: NPC131981

Ingredient ID: NPC130348

Ingredient ID: NPC130086

Ingredient ID: NPC129563

Ingredient ID: NPC127122

Ingredient ID: NPC126029

Ingredient ID: NPC125062

Ingredient ID: NPC12455

Ingredient ID: NPC124543

Ingredient ID: NPC122962

Ingredient ID: NPC122110

Ingredient ID: NPC120621

Ingredient ID: NPC119267

Ingredient ID: NPC119107

Ingredient ID: NPC119094

Ingredient ID: NPC118909

Ingredient ID: NPC113621

Ingredient ID: NPC112242

Ingredient ID: NPC111888

Ingredient ID: NPC109813

Ingredient ID: NPC108455

Ingredient ID: NPC105334

Ingredient ID: NPC102803

Ingredient ID: NPC101888

Ingredient ID: NPC101613