CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Phyllanthus Emblica

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TAGGGGGGGCCTGCGGAAGGATCATTGTCAAAACCTTGTACTGGTATGACCCGCGAACAAGTTTAGTCACTGCGGATGGTGCCTTGTGCACTTGAAGCCAGGCCACGCGGGGTGCTATGCTCCTTGCGGAGGCCACATAAACCAACCCCGGCGCGGAATGCGCCAAGGAAAACGAATCTAAAAGAGAGAACTCTACGTTCGCCTCGGAAACGATGTGTGCATGTAGTTGAATCTCCTTTCATAACCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCTTCGGGTCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCTCCCTCACTTCCCTCTTGTGGGGCTCGTGAATTGGGAGCGGAAAATGGCTTCCCATAAACTTCGAGATTGTGGTTGGCCCAAACATGAGACCAGGTCGGTCAGTGCCGTGGCATTCGGTGGTTGAAAATACCCTAAAAACGCCTCGTTCATTTGGCCGAACCAGCACGAATCTCAACGACCCTCTATGTATCCGACGCGACCCCAGGTCAGGCGCTACCCCTTG

Click for details-----ITS1

GGGTGAACATGTGGAAGGATCATTGTCAAAACCTTGTACTGGTATGACCCGCGAACAAGTTTAGTCACTGCGGATGGTGCCTTGTGCACTTGAAGCCAGGCCACGCGGGGTGCTATGCTCCTTGCGGAGGCCACATAAACCAACCCCGGCGCGGAATGCGCCAAGGAAAACGAATCTAAAAGAGAGAACTCTACGTTCGCCTCGGAAACGATGTGTGCATGTAGTTGAATCTCCTTTCATAACCAAAA

Click for details-----ITS2

AACGTCGCTCCCTCACTTCCCTCTTGTGGGGCTCGTGAATTGGGAGCGGAAAATGGCTTCCCATAAACTTCGAGATTGTGGTTGGCCCAAACATGAGACCAGGTCGGTCAGTGCCGTGGCATTCGGTGGTTGAAAATACCCTAAAAACGCCTCGTTCATTTGGCCGAACCAGCACGAATCTCAACGACCCTCTATGTATCCGACGCGACCCCGGGTCAGGCGGGATTACCCGC

Taxonomic Information

Plant ID: NPO28450
Plant Latin Name: Phyllanthus Emblica
Taxonomy Genus: Phyllanthus
Taxonomy Family: Phyllanthaceae

Plant External Links:

NCBI TaxonomyDB: 296036
Plant-of-the-World-Online: 353838-1

Used in Medicines

Country/Region:

Philippines; Indonesia; India; Malaysia; Vietnam; China; Laos; Sri Lanka; Thailand

Traditional Medicine System:

Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM

Geographical Distribution

Pakistan; Bangladesh; Myanmar; Cuba; Philippines; Indonesia; India; Cambodia; Mauritius; Malaysia; Trinidad and Tobago; Vietnam; China; Laos; Sri Lanka; Thailand; Taiwan

Geographical Distribution

−

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 19	CYP19A1	Cytochrome P450 19A1	P11511	CHEMBL1978
Cytochrome P450	Cytochrome P450 family 5	TBXAS1	Thromboxane-A synthase	P24557	CHEMBL1835
Drug Transporter	ATP-binding cassette	ABCG2	ATP-binding cassette sub-family G member 2	Q9UNQ0	CHEMBL5393
Drug Transporter	SLC superfamily of solute carriers	SLC22A6	Solute carrier family 22 member 6	Q4U2R8	CHEMBL1641347
Therapeutic Target	Cysteine protease	USP2	Ubiquitin carboxyl-terminal hydrolase 2	O75604	CHEMBL1293227
Therapeutic Target	Enzyme	PKM	Pyruvate kinase isozymes M1/M2	P14618	CHEMBL1075189
Therapeutic Target	Enzyme	HPGD	15-hydroxyprostaglandin dehydrogenase [NAD+]	P15428	CHEMBL1293255

Clinical trials type	Number of clinical trials
NP level	186
Plant level	1

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00000161	Randomized Trials of Vitamin Supplements and Eye Disease	cataract;macular degeneration	Ascorbate (NPC187770)	NP level
NCT00000541	Women's Antioxidant and Folic Acid Cardiovascular Study (WAFACS)	myocardial infarction;Myocardial Ischemia	Ascorbate (NPC187770)	NP level
NCT00000555	Women's Angiographic Vitamin and Estrogen Trial (WAVE)	menopause;Myocardial Ischemia	Ascorbate (NPC187770)	NP level
NCT00000600	Vitamin E and C to Slow Progression of Common Carotid Artery Plaque Build-Up	carotid artery disease;cerebral atherosclerosis;heart disease	Ascorbate (NPC187770)	NP level
NCT00006021	Arsenic Trioxide Plus Vitamin C in Treating Patients With Recurrent or Refractory Multiple Myeloma	multiple myeloma	Ascorbate (NPC187770)	NP level
NCT00067899	Oxidative Stress and Vitamin E Requirements	nicotine dependence	Ascorbate (NPC187770)	NP level
NCT00085345	Melphalan, Arsenic Trioxide, and Ascorbic Acid in Treating Patients With Relapsed or Refractory Multiple Myeloma	multiple myeloma	Ascorbate (NPC187770)	NP level
NCT00112879	Arsenic Trioxide, Ascorbic Acid, Dexamethasone, and Thalidomide in Treating Patients With Multiple Myeloma	multiple myeloma	Ascorbate (NPC187770)	NP level
NCT00184054	Trial of Arsenic Trioxide With Ascorbic Acid in the Treatment of Adult Non-Acute Promyelocytic Leukemia (APL) Acute Myelogenous Leukemia	acute myeloid leukemia	Ascorbate (NPC187770)	NP level
NCT00211562	Adjunctive Supplementation of Antioxidants (Vitamins E + C) Plus Omega-3 Fatty Acids	schizophrenia	Ascorbate (NPC187770)	NP level

Associated Disease of the Plant	Association Type & Detailed Evidence
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	NCT03522922
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	MAOA,MAOB
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AURKB,KDR,DPP4,INSR,AKR1B1
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	NFKB1,SRC,TP53,AURKB,GSK3B,FLT3,PIM1,AXL NCT00329498,NCT00184054
Acute promyelocytic leukaemia Disease Category: X.Extension Codes Disease ICD-11 Code: XH1A50	NCT03624270
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	NCT04404387
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	NFKB1
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	ACHE,CA7,MMP12,XDH,AURKB,CDK1,BLM,GPR35,TTR,CA12,THPO,NPSR1,TSHR
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	ACHE,CA7,POLB,DPP4,CA2,XDH,FYN,TOP1,RECQL,TEK,AURKB,CYP1B1,TBXAS1,HIF1A,BLM,NUAK1,CNR2,SNCA,TTR,MET,OR51E2,MAOB,ALOX15,PIM1,ABCG2,LCK,AXL,FUT7,ALOX5,NPSR1,CA14,LMNA
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	NOX4,TTR,OR51E2,FABP5,ALOX15 NCT01912820,NCT01080352

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Phyllanthus Emblica

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

210 All known Ingredients in Total

101 Ingredients with Acceptable Bioavailablity

95 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Acne vulgaris

Acquired hypomelanotic disorder

Acute diabete complication

Acute myeloid leukaemia

Acute promyelocytic leukaemia

Acute respiratory distress syndrome

Acute/subacute hepatic failure

Adenocarcinoma of bronchus or lung

Adenocarcinoma of pancreas

Adenocarcinoma of prostate

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities