CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Nandina Domestica

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TTGTAAAAAAAAATGTGAAAAAGGTTTTTTTGAGGACTTCGGAGACATTGTGAAACTGCAGAGCGAACGACCCGCGAACCCGGAAACACCCCCGACGGGGGGCGGGGGAAGGGGCGGGAGACCCGGATCCCTCCCCCCGCGGGCGCGCCCCGCGCGTCGAACAACAAACCCGGCGCGATCGGCGCCAAGGGAAAATCTGAGGAGAGCGTGCGTCCCCGCGCGAGCGGGACGGCGCCGCGACCCCGAAACCTATAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACACAGCGTCGCCCCCCTCCGCGTCTCTGCGGTAGGGGGAGCGGAGATTGGCCCCCCGTGCCTCACCCGGCGCGGGGCCCAAATGCCGGCCCCGGGGACGGGCGTCGCGATCATCGGTGGTTGAGAGACCCCCTCGTGTAGACCGGCGTCGCGCGCGCCCCGTCGCCCCGTGTGCGATGAACCCCGCGTCGCGCGAGCGGCGTCACCTGCGACCTCAGTCAGGGATTTTCCCCAAAAATTTTAACATTTCAAAAGGGGGAAAAA

Click for details-----ITS1

Click for details-----ITS2

ACAGCGTCGCCCCCCTCCGCGTCTCTGCGGTAGGGGGAGCGGAGATTGGCCCCCCGTGCCTCACCCGGCGCGGGGCCCAAATGCCGGCCCCGGGGACGGGCGTCGCGATCATCGGTGGTTGAGAGACCCCCTCGTGTAGACCGGCGTCGCGCGCGCCCCGTCGCCCCGTGTGCGATGAACCCCGCGTCGCGCGAGCGGCGTCACCTGCGACCTCAGTCAGGGATTTTCCCCAAAAATTTTAACATTTCAAAAGGGGGAAAAA

Taxonomic Information

Plant ID: NPO28410
Plant Latin Name: Nandina Domestica
Taxonomy Genus: Nandina
Taxonomy Family: Berberidaceae

Plant External Links:

NCBI TaxonomyDB: 41776
Plant-of-the-World-Online: 107544-1

Used in Medicines

Unknown.

Geographical Distribution

United States; South Africa

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

28 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

23 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

10 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC99659

Ingredient ID: NPC95292

Ingredient ID: NPC95075

Ingredient ID: NPC87241

Ingredient ID: NPC86469

Ingredient ID: NPC76079

Ingredient ID: NPC64839

Ingredient ID: NPC57095

Ingredient ID: NPC46390

Ingredient ID: NPC302527

Ingredient ID: NPC293514

Ingredient ID: NPC284653

Ingredient ID: NPC28320

Ingredient ID: NPC282631

Ingredient ID: NPC276944

Ingredient ID: NPC270275

Ingredient ID: NPC26601

Ingredient ID: NPC259732

Ingredient ID: NPC244968

Ingredient ID: NPC244257

Ingredient ID: NPC215470

Ingredient ID: NPC213696

Ingredient ID: NPC202768

Ingredient ID: NPC199465

Ingredient ID: NPC178455

Ingredient ID: NPC175792

Ingredient ID: NPC150879

Ingredient ID: NPC150540

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 2	CYP2D6	Cytochrome P450 2D6	P10635	CHEMBL289
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR1A	Serotonin 1a (5-HT1a) receptor	P08908	CHEMBL214
Therapeutic Target	Small molecule receptor (family A GPCR)	ADRA1A	Alpha-1a adrenergic receptor	P35348	CHEMBL229
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR7	Serotonin 7 (5-HT7) receptor	P34969	CHEMBL3155
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR2A	Serotonin 2a (5-HT2a) receptor	P28223	CHEMBL224
Therapeutic Target	Surface antigen	F3	Coagulation factor III	P13726	CHEMBL4081

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	HTR2A,HTR1A,HTR7
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	HTR1A,HTR2A,CYP2D6
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	HTR2A,HTR7,HTR1A
Bipolar disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60	HTR2A,HTR7,HTR1A
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	HTR1A,HTR7,HTR2A
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	HTR1A,HTR2A,HTR7
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	HTR1A,HTR7,HTR2A
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	HTR7,ADRA1A,HTR1A
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	HTR7,HTR1A,HTR2A
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	HTR1A HTR7
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	HTR2A,F3
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	HTR2A,HTR1A
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	HTR2A,HTR1A
Sexual dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA00-HA01	HTR2A,HTR1A
Social anxiety disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B04	HTR2A,HTR1A
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	HTR1A,HTR2A
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	ADRA1A,HTR1A
Mood disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60-6E23	HTR1A,HTR2A
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	HTR7,HTR2A
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	HTR7,HTR2A
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	F3,ADRA1A
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	HTR7,HTR2A
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	HTR2A
Ejaculatory dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA03	HTR1A
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	HTR1A
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F3
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	HTR1A
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	F3
Intellectual development disorder Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD90	HTR1A
Bulimia nervosa Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B81	HTR1A
Coronary atherosclerosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA80	HTR1A
Prostate hyperplasia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA90	ADRA1A
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	HTR2A
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	HTR1A
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	HTR2A
Chronic insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00	HTR2A
Sleep-wake disorder Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7B2Z	HTR2A
Hypoactive sexual desire dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA00	HTR1A
Skin/mucosal anomaly Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD27	HTR1A
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	HTR2A
Cerebral ischaemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B1Z	HTR2A
Post-traumatic stress disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B40	HTR2A
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ADRA1A
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	HTR2A
Schizoaffective disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A21	HTR2A
Tonus and reflex abnormality Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB47	HTR1A
Muscular atrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B61	HTR1A
Malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F40-1F45	CYP2D6
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	HTR2A
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	ADRA1A
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	HTR2A
Juvenile idiopathic arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA24	HTR1A
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	HTR2A
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	F3
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	HTR7
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	F3
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	HTR7
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	HTR2A
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	HTR7
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	F3
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	HTR7
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F3
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	HTR7
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	HTR7
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	F3
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CYP2D6
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CYP2D6
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	HTR2A
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	HTR2A

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Nandina Domestica

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

28 All known Ingredients in Total

23 Ingredients with Acceptable Bioavailablity

10 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Parkinsonism

Insomnia

Alzheimer disease

Bipolar disorder

Schizophrenia

Attention deficit hyperactivity disorder

Depression

Mild neurocognitive disorder

Pheochromocytoma

Psoriasis

Pancreatic cancer

Dementia

Psychotic disorder

Sexual dysfunction

Social anxiety disorder

Anxiety

Pulmonary hypertension

Mood disorder

Adenocarcinoma of pancreas

Mesothelioma of pleura

Chikungunya virus disease

Malignant neoplasms of thymus

Idiopathic interstitial pneumonitis

Ejaculatory dysfunction

Postoperative inflammation

Bleeding disorder

Malignant haematopoietic neoplasm

Acute respiratory distress syndrome

Intellectual development disorder

Bulimia nervosa

Coronary atherosclerosis

Prostate hyperplasia

Chronic kidney disease

Migraine

Glaucoma

Chronic insomnia

Sleep-wake disorder

Hypoactive sexual desire dysfunction

Skin/mucosal anomaly

Pituitary gland disorder

Cerebral ischaemia

Post-traumatic stress disorder

Pain, unspecified

Chronic pain

Schizoaffective disorder

Tonus and reflex abnormality

Muscular atrophy

Malaria

Acute diabete complication

Prostate cancer

Cardiovascular disease

Juvenile idiopathic arthritis

Type 2 diabetes mellitus

Solid tumour/cancer

Carcinosarcoma of uterus

Malignant neoplasms of biliary tract, distal bile duct

Leishmaniasis

Idiopathic pulmonary fibrosis

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Diffuse large B-cell lymphomas

Squamous cell carcinoma of bronchus or lung

Tetralogy of Fallot

Other specified malignant neoplasms of kidney, except renal pelvis

Cytomegaloviral disease