• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Corydalis Pallida


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AACCTGCCCAGCAGAACGACCCGCGAACACGTGATGCCCCCGGTTACGCCGGACGAGGAGGGAGCGGAGACGCCCCCGCCCCGCCCGGAACAAACGAACCCCCGGCGCGATCCGCGCCAAGGAAAACGAAAAAACGGATCTTGCGCCCCGCAAGGACGCGCTCCCCGAGCTCTTAACGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCTAGGCCGTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCACCGAGTCGCCCCCATCCCCCCGCCTCTCTCCATTCCGGAGGGACGGGGCGTTGGGAGCGGAGAATGGCCCCCCGTGCCCCCGAGCGCGGCCGGCCCAAATCGAGGCCCCCCGGAGGCCGACGTCACGATCCGTGGTGGTTGTAAAAGACACGCCCTAGAAATCGGATCCCGTGCACGCCGCGCCGCACCCCGGGAGGCCACAGCGACCCCCAAGGGCCGTCCCCCGGACGGCACCCACTCTG

Click for details-----ITS1

AACCTGCCCAGCAGAACGACCCGCGAACACGTGATGCCCCCGGTTACGCCGGACGAGGAGGGAGCGGAGACGCCCCCGCCCCGCCCGGAACAAACGAACCCCCGGCGCGATCCGCGCCAAGGAAAACGAAAAAACGGATCTTGCGCCCCGCAAGGACGCGCTCCCCGAGCTCTTAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO28372
Plant Latin Name: Corydalis Pallida
Taxonomy Genus: Corydalis
Taxonomy Family: Papaveraceae

Plant External Links:

NCBI TaxonomyDB: 38903
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

117 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


48 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

26 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98535

Ingredient ID: NPC97556

Ingredient ID: NPC97291

Ingredient ID: NPC95906

Ingredient ID: NPC94314

Ingredient ID: NPC92650

Ingredient ID: NPC87582

Ingredient ID: NPC8722

Ingredient ID: NPC85925

Ingredient ID: NPC82800

Ingredient ID: NPC70147

Ingredient ID: NPC6984

Ingredient ID: NPC69432

Ingredient ID: NPC69109

Ingredient ID: NPC65453

Ingredient ID: NPC62559

Ingredient ID: NPC60291

Ingredient ID: NPC55348

Ingredient ID: NPC51957

Ingredient ID: NPC50771

Ingredient ID: NPC44957

Ingredient ID: NPC44905

Ingredient ID: NPC42605

Ingredient ID: NPC41315

Ingredient ID: NPC39701

Ingredient ID: NPC37832

Ingredient ID: NPC36362

Ingredient ID: NPC32163

Ingredient ID: NPC32141

Ingredient ID: NPC317142

Ingredient ID: NPC315274

Ingredient ID: NPC314828

Ingredient ID: NPC31326

Ingredient ID: NPC307065

Ingredient ID: NPC305900

Ingredient ID: NPC304032

Ingredient ID: NPC303581

Ingredient ID: NPC299536

Ingredient ID: NPC296496

Ingredient ID: NPC296073

Ingredient ID: NPC294419

Ingredient ID: NPC29341

Ingredient ID: NPC293160

Ingredient ID: NPC292489

Ingredient ID: NPC2918

Ingredient ID: NPC288580

Ingredient ID: NPC285117

Ingredient ID: NPC275625

Ingredient ID: NPC268826

Ingredient ID: NPC268214

Ingredient ID: NPC265844

Ingredient ID: NPC261228

Ingredient ID: NPC254633

Ingredient ID: NPC249797

Ingredient ID: NPC243670

Ingredient ID: NPC237685

Ingredient ID: NPC236824

Ingredient ID: NPC236709

Ingredient ID: NPC234392

Ingredient ID: NPC232562

Ingredient ID: NPC228395

Ingredient ID: NPC226284

Ingredient ID: NPC222847

Ingredient ID: NPC218196

Ingredient ID: NPC215206

Ingredient ID: NPC214610

Ingredient ID: NPC211965

Ingredient ID: NPC211105

Ingredient ID: NPC206442

Ingredient ID: NPC204820

Ingredient ID: NPC204254

Ingredient ID: NPC201551

Ingredient ID: NPC199478

Ingredient ID: NPC196069

Ingredient ID: NPC192657

Ingredient ID: NPC191472

Ingredient ID: NPC190364

Ingredient ID: NPC189126

Ingredient ID: NPC180473

Ingredient ID: NPC17778

Ingredient ID: NPC175216

Ingredient ID: NPC17454

Ingredient ID: NPC171409

Ingredient ID: NPC169718

Ingredient ID: NPC168957

Ingredient ID: NPC168206

Ingredient ID: NPC161617

Ingredient ID: NPC16107

Ingredient ID: NPC160573

Ingredient ID: NPC157912

Ingredient ID: NPC154288

Ingredient ID: NPC150919

Ingredient ID: NPC13916

Ingredient ID: NPC134386

Ingredient ID: NPC133926

Ingredient ID: NPC131204

Ingredient ID: NPC127153

Ingredient ID: NPC12673

Ingredient ID: NPC125945

Ingredient ID: NPC125589

Ingredient ID: NPC123587

Ingredient ID: NPC122510

Ingredient ID: NPC121745

Ingredient ID: NPC121400

Ingredient ID: NPC121319

Ingredient ID: NPC121205

Ingredient ID: NPC118478

Ingredient ID: NPC114942

Ingredient ID: NPC114364

Ingredient ID: NPC113864

Ingredient ID: NPC113773

Ingredient ID: NPC110899

Ingredient ID: NPC109308

Ingredient ID: NPC107066

Ingredient ID: NPC101638

Ingredient ID: NPC101508

Ingredient ID: NPC100634