• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ulva Prolifera


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AACCAATCACAGAGCACCTGCGGGCGCTCGCTCCCCTCGGGGGGCGAGGGCCCGCCGTTTACAGGATCCGCCGGCGCGTGAGCTCCCCTCGGGGGGCGACCGCGCCGGGCCGGAGCCCTAACCCATTGAACCCTCTGCCCTGAAGCAGCTTCGCACGGGGACACCCCTGCGATAGTAACTGAGACAACTCTCAACAACGGATATCTTGGCTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCCGGTCGACTCTTCGGAGGAGACCACATCTGCCTCAGCGTCGGAATACCCCCTCACGCACCCCCGCGTGGACCTGGCCCCCCCGGACGCCTCGGCGCCCGGGCCGGCTGAAATGCAGAGGCTCGTGCGCGGCCCATTCGTGGCCCCGACTAGGTAGGTAGCTCGCTACTTCTAGGGCGGGTGGCTCGGGTGTCGCGTGCTGTGGGCCGAAAGGATAACCAATCCATTCATTCGACCTGGAGTTCAGGTGGAGGGCCTAACCCGGCCTGGAACTTTAGGCATATACCATTAAGGCGCGAGAGAAGGGAGAAA

Click for details-----ITS1

TTCCGTAGGTGTACCTGCGGAGGGATCATTGAAACCGATCACACCAATCACAGAGCACCTGCGGGCGCTCGCTCCCCTCGGGGGGCGAGGGCCCGCCGTTTACAGGATGCGCCGGCGCGTGAGCTCCCCTCGGGGCGCGACCGCGCCGGGCCGGAGCCCTAACCCATTGAACCCTCTGCCCTGAAGCAGCTTCGCACGGGGACACCCCTGCGATAGTAACTGAGA

Click for details-----ITS2

TACCCCCTCACGCACCCCCGCGTGGACCTGGCCCCCCCGGACGCCTCGGCGCCCGGGCCGGCTGAAATGCAGAGGCTCGTGCGCGGCCCATTCGTGGCCCCGACTAGGTAGGTAGCTCGCTACTTCTAGGGCGGGTGGCTCGGGTGTCGCGTGCTGTGGGCCGAAAGGATAACCAATCCATTCATTCGACCTGGAGTTCAGGTGGAGGGCCTAACCCGGCCTGGAACTTTAGGCATATACCATTAAGGCGCGAGAGAAGGGAGAAA
Taxonomic Information

Plant ID: NPO28319
Plant Latin Name: Ulva Prolifera
Taxonomy Genus: Ulva
Taxonomy Family: Ulvaceae

Plant External Links:

NCBI TaxonomyDB: 3117
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

115 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


88 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

45 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96613

Ingredient ID: NPC90232

Ingredient ID: NPC85813

Ingredient ID: NPC84771

Ingredient ID: NPC83702

Ingredient ID: NPC77249

Ingredient ID: NPC76314

Ingredient ID: NPC71394

Ingredient ID: NPC69871

Ingredient ID: NPC68267

Ingredient ID: NPC56448

Ingredient ID: NPC4465

Ingredient ID: NPC43520

Ingredient ID: NPC43360

Ingredient ID: NPC37132

Ingredient ID: NPC3707

Ingredient ID: NPC34903

Ingredient ID: NPC307945

Ingredient ID: NPC3016

Ingredient ID: NPC301585

Ingredient ID: NPC299505

Ingredient ID: NPC298802

Ingredient ID: NPC297117

Ingredient ID: NPC29678

Ingredient ID: NPC294548

Ingredient ID: NPC293249

Ingredient ID: NPC292825

Ingredient ID: NPC28657

Ingredient ID: NPC286052

Ingredient ID: NPC283011

Ingredient ID: NPC279974

Ingredient ID: NPC274729

Ingredient ID: NPC27407

Ingredient ID: NPC27349

Ingredient ID: NPC27243

Ingredient ID: NPC26974

Ingredient ID: NPC267741

Ingredient ID: NPC266359

Ingredient ID: NPC264833

Ingredient ID: NPC263785

Ingredient ID: NPC26229

Ingredient ID: NPC261831

Ingredient ID: NPC260691

Ingredient ID: NPC258220

Ingredient ID: NPC257383

Ingredient ID: NPC255647

Ingredient ID: NPC249578

Ingredient ID: NPC249194

Ingredient ID: NPC247835

Ingredient ID: NPC243728

Ingredient ID: NPC23925

Ingredient ID: NPC238041

Ingredient ID: NPC23795

Ingredient ID: NPC233481

Ingredient ID: NPC230923

Ingredient ID: NPC23046

Ingredient ID: NPC230301

Ingredient ID: NPC229216

Ingredient ID: NPC228906

Ingredient ID: NPC22260

Ingredient ID: NPC222153

Ingredient ID: NPC222147

Ingredient ID: NPC220759

Ingredient ID: NPC219560

Ingredient ID: NPC217914

Ingredient ID: NPC216630

Ingredient ID: NPC216187

Ingredient ID: NPC216127

Ingredient ID: NPC2114

Ingredient ID: NPC209970

Ingredient ID: NPC207632

Ingredient ID: NPC202651

Ingredient ID: NPC201950

Ingredient ID: NPC201844

Ingredient ID: NPC199773

Ingredient ID: NPC196924

Ingredient ID: NPC196370

Ingredient ID: NPC196227

Ingredient ID: NPC19404

Ingredient ID: NPC189092

Ingredient ID: NPC187445

Ingredient ID: NPC179798

Ingredient ID: NPC17599

Ingredient ID: NPC168030

Ingredient ID: NPC163755

Ingredient ID: NPC162742

Ingredient ID: NPC158963

Ingredient ID: NPC155461

Ingredient ID: NPC154186

Ingredient ID: NPC153958

Ingredient ID: NPC151250

Ingredient ID: NPC149184

Ingredient ID: NPC148403

Ingredient ID: NPC145444

Ingredient ID: NPC145277

Ingredient ID: NPC143008

Ingredient ID: NPC142349

Ingredient ID: NPC142027

Ingredient ID: NPC139473

Ingredient ID: NPC138222

Ingredient ID: NPC136932

Ingredient ID: NPC126750

Ingredient ID: NPC126503

Ingredient ID: NPC123965

Ingredient ID: NPC120151

Ingredient ID: NPC119802

Ingredient ID: NPC119036

Ingredient ID: NPC116726

Ingredient ID: NPC113733

Ingredient ID: NPC107860

Ingredient ID: NPC107629

Ingredient ID: NPC106770

Ingredient ID: NPC105354

Ingredient ID: NPC105267

Ingredient ID: NPC104050