• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Aegilops Geniculata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGTGACCCTGACCAAAACAGACCGCGCACGCGTCATCCAATCCGTCGGCGAGCGCACCGTCCGTCGCTCGGCCAATGCCTCGACCACCTCCCCTCCTCGGAGCGGGTGGGGGCTCGGGGTACAAGAACCCACGGCGCCGAAGGCGTCAAGGAACCTGTGCCTAACCAGGGGGCATGGCTAGGCYTGCTAGCCGTCCCTCGTGATTGCAAATCTATTTAATCCACACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACCTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTCGGCCGAGGGGCAGCCTGCCTGGGCGTCACGCCAAAACACGCTCCCAACCACCCTCATCGGGAATCGGGATGCGGCATCTGGTCCCTYGTCTCGCAAGGGGCGGTGGACCGAAGATCGGGCTGCCGGTGTACCGCGCCGGACACAGCGCATGGTGGGCGTCCTCGCTTTATCAACGCAGTGYATCCGACGCGCARCCGGCATTATGGCCTCAGAACGACCCAGCAAAGCAAGCGCATCGGCTTCGACC

Click for details-----ITS1

TCGTGACCCTGACCAAAACAGACCGCGCACGCGTCATCCAATCCGTCGGCGAGCGCACCGTCCGTCGCTCGGCCAATGCCTCGACCACCTCCCCTCCTCGGAGCGGGTGGGGGCTCGGGGTACAAGAACCCACGGCGCCGAAGGCGTCAAGGAACCTGTGCCTAACCAGGGGGCATGGCTAGGCYTGCTAGCCGTCCCTCGTGATTGCAAATCTATTTAATCCACA

Click for details-----ITS2

CAAAACACGCTCCCAACCACCCTCATCGGGAATCGGGATGCGGCATCTGGTCCCTYGTCTCGCAAGGGGCGGTGGACCGAAGATCGGGCTGCCGGTGTACCGCGCCGGACACAGCGCATGGTGGGCGTCCTCGCTTTATCAACGCAGTGYATCCGACGCGCARCCGGCATTATGGCCTCAGAACGACCCAGCAAAGCAAGCGCATCGGCTTCGACC
Taxonomic Information

Plant ID: NPO28293
Plant Latin Name: Aegilops Geniculata
Taxonomy Genus: Aegilops
Taxonomy Family: Poaceae

Plant External Links:

NCBI TaxonomyDB: 130459
Plant-of-the-World-Online: 384596-1

Used in Medicines

Unknown.

Geographical Distribution

Turkey; Afghanistan; Romania; Albania; Iran; Libya; Algeria; Egypt; France; Portugal; Morocco; Tunisia; Greece; Italy; United States; Cyprus; Russia; Spain; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

25 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


8 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

10 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC92056

Ingredient ID: NPC68637

Ingredient ID: NPC66962

Ingredient ID: NPC61535

Ingredient ID: NPC58579

Ingredient ID: NPC57781

Ingredient ID: NPC55602

Ingredient ID: NPC37965

Ingredient ID: NPC305932

Ingredient ID: NPC290598

Ingredient ID: NPC290495

Ingredient ID: NPC27765

Ingredient ID: NPC257610

Ingredient ID: NPC248703

Ingredient ID: NPC233221

Ingredient ID: NPC230301

Ingredient ID: NPC223186

Ingredient ID: NPC219852

Ingredient ID: NPC207379

Ingredient ID: NPC195334

Ingredient ID: NPC163970

Ingredient ID: NPC158961

Ingredient ID: NPC149300

Ingredient ID: NPC133671

Ingredient ID: NPC131713

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Cytochrome P450 Cytochrome P450 family 5 TBXAS1 Thromboxane-A synthase P24557 CHEMBL1835
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Lyase CA7 Carbonic anhydrase VII P43166 CHEMBL2326
Therapeutic Target Lyase CA2 Carbonic anhydrase II P00918 CHEMBL205
Therapeutic Target Methyl-lysine/arginine binding protein L3MBTL1 Lethal(3)malignant brain tumor-like protein 1 Q9Y468 CHEMBL1287622
Therapeutic Target Nuclear hormone receptor subfamily 1 NR1H4 Bile acid receptor FXR Q96RI1 CHEMBL2047
Therapeutic Target Protein Kinase MAPK1 MAP kinase ERK2 P28482 CHEMBL4040
Therapeutic Target Protein Kinase LCK Tyrosine-protein kinase LCK P06239 CHEMBL258
Therapeutic Target Protein Kinase FYN Tyrosine-protein kinase FYN P06241 CHEMBL1841
Therapeutic Target Protein Kinase MAPK14 MAP kinase p38 alpha Q16539 CHEMBL260
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level2
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT02644200 Gelatin Tannate as Treatment for Acute Childhood Gastroenteritis gastroenteritis Tannic Acid (NPC149300) NP level
NCT02280759 Efficacy of Gelatin Tannate in Treatment Acute Gastroenteritis in Children. gastroenteritis Tannic Acid (NPC149300) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 CA7,LCK,FYN,TBXAS1,CA2,F2
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 MAPK1,CA12,CA2,LCK,FYN
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CYP1A2,TBXAS1,CA12,CA2,LCK
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 CA7,CA2,LCK,TBXAS1
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 CA12,CA7,LCK,TBXAS1
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 LCK,TBXAS1,CA12,CA2
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 CA12,MAPK1,F2,TBXAS1
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 CA7,CA12,F2
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 CA12,L3MBTL1,CA12
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CA7,CA12,F2
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CYP1A2,CA2,CA12
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 CA12,CA2
Myeloproliferative neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A20
 LCK,FYN
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 MAPK14,CA2
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 F2,TBXAS1
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA12,CA2
Postoperative inflammation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-CA43
 LCK,MAPK14
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 LCK,F2
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA2,CA12
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 MAPK14,F2
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 TBXAS1,F2
Multiple myeloma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A83
 FYN,LCK
Angina pectoris
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40
 F2,TBXAS1
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 TBXAS1,F2
Gastroenteritis or colitis without specification of origin
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A40.0
 NCT02280759,NCT02644200
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 CA12,L3MBTL1
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 LCK,TBXAS1
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 F2,TBXAS1
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 CYP1A2,CA2
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 CA2,LCK
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CA12,CA7
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 CA2,F2
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 CA12,CA7
Coronary thrombosis
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA43
 F2
Coronary atherosclerosis
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA80
 MAPK14
Chronic obstructive pulmonary disease
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA22
 MAPK14
Cerebral ischaemic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B11
 F2
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 F2
Melanoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 MAPK1
Nutritional deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B50-5B71
 F2
Coagulation defect
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B10
 F2
Heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10-BD1Z
 CA2
Vitamin deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B55-5B5F
 MAPK14
Bleeding disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20-GA21
 F2
Ischaemic/haemorrhagic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B20
 F2
Essential hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00
 CA2
Low bone mass disorder
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB83
 CA2
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 MAPK14
Indeterminate colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD72
 TBXAS1
Thrombocytopenia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64
 F2
Intrathoracic organs injury
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NB32
 MAPK14
Arteries/arterioles disorder
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD52
 MAPK1
Duodenal ulcer
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA63
 CA2
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 MAPK1
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 CA2
Insomnia
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A00-7A0Z
 CA2
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 CA2
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 CA12
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 L3MBTL1
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 F2
Atrial fibrillation
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC81.3
 CA7
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 F2
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 CA12
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 F2
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 F2
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 CA12
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 CA2
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 TBXAS1
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 CA12
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 FYN

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group