• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Senna Alexandrina


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGTTTCCGTAGGTGAACCCTGCGGAAGGATCAATTGTCGGATGCCTCGCAAACAAGGAAGACCCCGCGAATCGGTTGAACCAATCCTGGGGAGGGAGGCGAGGGGCGTGCATTGCCTCGAGTCCCTAGCCCCATGCCAGGGGTGCGAGTGCGGCCTCGTGTTGCAAAGCACCCCGGGCAACACAACTACCGCAAACCCCGACGCGAGAAGCGTCAAGGAACTCAAACAAAAGTGCGTGGCCTCGGCGACCCGGAGACGGATCTCGTTCGCGGCCAGCAGCGAAAATGATGTCTAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGTGTCMCGCATCGTTGCCCCAAACCACGTCGTCCCTCCGGTCTGTCGGAGCGGGCGAGGTGGTTGGGCGGGAKGTTGGCCTCYCGTGAGCCCCCTGCCTCGCGGATGGTTGTAARTGSAGCCTGTGGGGGGCGACCGCSATGTTCCACGGTGGATGAGCAGATGCCTCGAGACCGACCGTGCGCGAGTTGTCCCTACGGCTAGGCTGCGAGACCCTTGCGAGCGAGGAAGCGCTCCCAACGCGACCCC

Click for details-----ITS1

GGTTTCCGTAGGTGAACCCTGCGGAAGGATCAATTGTCGGATGCCTCGCAAACAAGGAAGACCCCGCGAATCGGTTGAACCAATCCTGGGGAGGGAGGCGAGGGGCGTGCATTGCCTCGAGTCCCTAGCCCCATGCCAGGGGTGCGAGTGCGGCCTCGTGTTGCAAAGCACCCCGGGCAACACAACTACCGCAAACCCCGACGCGAGAAGCGTCAAGGAACTCAAACAAAAGTGCGTGGCCTCGGCGACCCGGAGACGGATCTCGTTCGCGGCCAGCAGCGAAAATGATGTCTAGAA

Click for details-----ITS2

ATCGTTGCCCCAATGCCTTGGCCTCGTGCTAGGCATCGAGCTGGGCGAATGCTGGCTTCCCGCGAGCAACGCCTCACGGTTGGTTGAAAACTGAGTCCGTGGTGGGTGGCGCCTTGACGGATGGTGGTTGAGTCAAAGAAAGCTCGGGACCCATCGTGGTTGTCACCCGCACCGGCATTGTGACTCTATGATCCATGAGCGTTTGTTGGTCGCCCAAGACGGGACCTCAGGTCAGGCGAG
Taxonomic Information

Plant ID: NPO28260
Plant Latin Name: Senna Alexandrina
Taxonomy Genus: Senna
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 72402
Plant-of-the-World-Online: 518323-1

Used in Medicines

Country/Region:
India; Indonesia; Jordan

Traditional Medicine System:
Unani; Indian Folk; Homeopathy; Ayurveda; Siddha

Geographical Distribution

Brazil; Mauritania; Sudan; Ethiopia; Somalia; Nigeria; Benin; Saudi Arabia; Algeria; Russia; Jordan; Dominican Republic; Iraq; Eritrea; Oman; Indonesia; United States; Mali; Yemen; Haiti; Pakistan; Chad; Mexico; Egypt; India; Uzbekistan; Djibouti; Colombia; Sri Lanka; Kenya; Niger; Tajikistan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

283 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


225 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

162 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC9880

Ingredient ID: NPC96630

Ingredient ID: NPC96218

Ingredient ID: NPC92403

Ingredient ID: NPC92111

Ingredient ID: NPC91574

Ingredient ID: NPC90949

Ingredient ID: NPC90566

Ingredient ID: NPC90232

Ingredient ID: NPC89422

Ingredient ID: NPC89069

Ingredient ID: NPC88759

Ingredient ID: NPC88566

Ingredient ID: NPC87828

Ingredient ID: NPC85944

Ingredient ID: NPC84266

Ingredient ID: NPC84030

Ingredient ID: NPC82648

Ingredient ID: NPC78551

Ingredient ID: NPC78500

Ingredient ID: NPC76145

Ingredient ID: NPC76112

Ingredient ID: NPC75158

Ingredient ID: NPC7491

Ingredient ID: NPC74715

Ingredient ID: NPC71853

Ingredient ID: NPC71818

Ingredient ID: NPC71703

Ingredient ID: NPC71092

Ingredient ID: NPC70622

Ingredient ID: NPC69884

Ingredient ID: NPC69445

Ingredient ID: NPC68889

Ingredient ID: NPC67986

Ingredient ID: NPC67761

Ingredient ID: NPC66820

Ingredient ID: NPC66681

Ingredient ID: NPC66624

Ingredient ID: NPC66577

Ingredient ID: NPC61248

Ingredient ID: NPC60394

Ingredient ID: NPC59581

Ingredient ID: NPC59570

Ingredient ID: NPC58970

Ingredient ID: NPC58616

Ingredient ID: NPC57234

Ingredient ID: NPC57051

Ingredient ID: NPC56112

Ingredient ID: NPC54264

Ingredient ID: NPC51758

Ingredient ID: NPC50768

Ingredient ID: NPC50629

Ingredient ID: NPC49151

Ingredient ID: NPC49053

Ingredient ID: NPC46248

Ingredient ID: NPC45727

Ingredient ID: NPC45270

Ingredient ID: NPC44751

Ingredient ID: NPC43822

Ingredient ID: NPC43812

Ingredient ID: NPC43728

Ingredient ID: NPC42471

Ingredient ID: NPC424

Ingredient ID: NPC4079

Ingredient ID: NPC40249

Ingredient ID: NPC40139

Ingredient ID: NPC39249

Ingredient ID: NPC38751

Ingredient ID: NPC38497

Ingredient ID: NPC37644

Ingredient ID: NPC3649

Ingredient ID: NPC35412

Ingredient ID: NPC34764

Ingredient ID: NPC322992

Ingredient ID: NPC32279

Ingredient ID: NPC3224

Ingredient ID: NPC3155

Ingredient ID: NPC312929

Ingredient ID: NPC312208

Ingredient ID: NPC312132

Ingredient ID: NPC311470

Ingredient ID: NPC309606

Ingredient ID: NPC308749

Ingredient ID: NPC308218

Ingredient ID: NPC306990

Ingredient ID: NPC30433

Ingredient ID: NPC301696

Ingredient ID: NPC301585

Ingredient ID: NPC301344

Ingredient ID: NPC301195

Ingredient ID: NPC300684

Ingredient ID: NPC296337

Ingredient ID: NPC295777

Ingredient ID: NPC294548

Ingredient ID: NPC294344

Ingredient ID: NPC294136

Ingredient ID: NPC293343

Ingredient ID: NPC290442

Ingredient ID: NPC290078

Ingredient ID: NPC289974

Ingredient ID: NPC288963

Ingredient ID: NPC288932

Ingredient ID: NPC288089

Ingredient ID: NPC287660

Ingredient ID: NPC287550

Ingredient ID: NPC287331

Ingredient ID: NPC28657

Ingredient ID: NPC285793

Ingredient ID: NPC285470

Ingredient ID: NPC284876

Ingredient ID: NPC284731

Ingredient ID: NPC283682

Ingredient ID: NPC283655

Ingredient ID: NPC282923

Ingredient ID: NPC282909

Ingredient ID: NPC279404

Ingredient ID: NPC279026

Ingredient ID: NPC278683

Ingredient ID: NPC278175

Ingredient ID: NPC278072

Ingredient ID: NPC277907

Ingredient ID: NPC277704

Ingredient ID: NPC277369

Ingredient ID: NPC275462

Ingredient ID: NPC273385

Ingredient ID: NPC270485

Ingredient ID: NPC26960

Ingredient ID: NPC269499

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC268564

Ingredient ID: NPC268075

Ingredient ID: NPC264505

Ingredient ID: NPC261831

Ingredient ID: NPC261553

Ingredient ID: NPC261080

Ingredient ID: NPC260480

Ingredient ID: NPC259512

Ingredient ID: NPC259134

Ingredient ID: NPC258672

Ingredient ID: NPC257124

Ingredient ID: NPC256651

Ingredient ID: NPC254847

Ingredient ID: NPC250560

Ingredient ID: NPC250539

Ingredient ID: NPC249801

Ingredient ID: NPC248726

Ingredient ID: NPC247786

Ingredient ID: NPC246358

Ingredient ID: NPC246165

Ingredient ID: NPC243062

Ingredient ID: NPC240817

Ingredient ID: NPC239406

Ingredient ID: NPC239039

Ingredient ID: NPC237837

Ingredient ID: NPC236606

Ingredient ID: NPC236355

Ingredient ID: NPC233533

Ingredient ID: NPC233209

Ingredient ID: NPC232926

Ingredient ID: NPC232375

Ingredient ID: NPC231738

Ingredient ID: NPC229403

Ingredient ID: NPC227670

Ingredient ID: NPC227378

Ingredient ID: NPC225783

Ingredient ID: NPC225243

Ingredient ID: NPC223468

Ingredient ID: NPC223455

Ingredient ID: NPC22229

Ingredient ID: NPC222001

Ingredient ID: NPC221192

Ingredient ID: NPC216630

Ingredient ID: NPC216127

Ingredient ID: NPC215451

Ingredient ID: NPC215118

Ingredient ID: NPC214584

Ingredient ID: NPC213935

Ingredient ID: NPC213749

Ingredient ID: NPC210659

Ingredient ID: NPC209970

Ingredient ID: NPC209279

Ingredient ID: NPC209275

Ingredient ID: NPC20791

Ingredient ID: NPC20742

Ingredient ID: NPC201844

Ingredient ID: NPC20045

Ingredient ID: NPC196924

Ingredient ID: NPC196490

Ingredient ID: NPC194586

Ingredient ID: NPC190961

Ingredient ID: NPC190810

Ingredient ID: NPC190301

Ingredient ID: NPC189036

Ingredient ID: NPC187796

Ingredient ID: NPC187061

Ingredient ID: NPC186266

Ingredient ID: NPC185189

Ingredient ID: NPC182727

Ingredient ID: NPC18259

Ingredient ID: NPC182102

Ingredient ID: NPC180871

Ingredient ID: NPC180684

Ingredient ID: NPC179969

Ingredient ID: NPC179831

Ingredient ID: NPC178223

Ingredient ID: NPC176819

Ingredient ID: NPC176589

Ingredient ID: NPC176309

Ingredient ID: NPC175342

Ingredient ID: NPC173996

Ingredient ID: NPC173856

Ingredient ID: NPC170018

Ingredient ID: NPC168552

Ingredient ID: NPC16728

Ingredient ID: NPC167132

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC164646

Ingredient ID: NPC163984

Ingredient ID: NPC163556

Ingredient ID: NPC16157

Ingredient ID: NPC161555

Ingredient ID: NPC161097

Ingredient ID: NPC158270

Ingredient ID: NPC158028

Ingredient ID: NPC157298

Ingredient ID: NPC156768

Ingredient ID: NPC156655

Ingredient ID: NPC156654

Ingredient ID: NPC155263

Ingredient ID: NPC155246

Ingredient ID: NPC155182

Ingredient ID: NPC154515

Ingredient ID: NPC154186

Ingredient ID: NPC153958

Ingredient ID: NPC153500

Ingredient ID: NPC14917

Ingredient ID: NPC147343

Ingredient ID: NPC14682

Ingredient ID: NPC146316

Ingredient ID: NPC145022

Ingredient ID: NPC144023

Ingredient ID: NPC141777

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC138113

Ingredient ID: NPC13789

Ingredient ID: NPC137050

Ingredient ID: NPC136996

Ingredient ID: NPC136232

Ingredient ID: NPC136188

Ingredient ID: NPC135077

Ingredient ID: NPC134022

Ingredient ID: NPC131981

Ingredient ID: NPC131108

Ingredient ID: NPC130683

Ingredient ID: NPC129417

Ingredient ID: NPC129039

Ingredient ID: NPC129002

Ingredient ID: NPC128825

Ingredient ID: NPC12771

Ingredient ID: NPC126240

Ingredient ID: NPC126102

Ingredient ID: NPC125169

Ingredient ID: NPC125144

Ingredient ID: NPC125062

Ingredient ID: NPC117543

Ingredient ID: NPC117493

Ingredient ID: NPC116775

Ingredient ID: NPC116013

Ingredient ID: NPC115003

Ingredient ID: NPC114239

Ingredient ID: NPC113928

Ingredient ID: NPC112701

Ingredient ID: NPC111888

Ingredient ID: NPC109813

Ingredient ID: NPC108494

Ingredient ID: NPC107546

Ingredient ID: NPC106250

Ingredient ID: NPC105591

Ingredient ID: NPC101285