CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Strychnos Nux-Vomica

Example Image

PLANiTS DNA barcode

Click for details-----ITS

GCTTTGGGACTGCGGAGGACATTGTCGATCCTGCAGACGACCCGCGAACTCGTTACTCTCCACGGGCGTCGGGAGGGGGCAACCCCGCCTCGGCCCCGTCTCGCGAGCGGCCCGATCCCTCGGGTGCCGGGCCGCGCGCAAACAACGAACCCCGGCGCGGAAAGCGCCAAGGAAAACTTTCACGGATAGCCCGGCCCTCGCGGCCCCGTTCGCGGTGCGCCCGGGGGCGATCGGCATCTACCTGAAATTAAAACAACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCAAACTGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCCCCCACACGCCCTCTCGGGCCGTGCGGGAGGGGACGGACAATGGCCTCCCGTGCTAGCGCGCGGTTGGCCTAAATGAGAGTCCCTCACGACGGGCGTCACGACAAGTGGTGGTTGAATGCCTCAACTCGCATAGCTGTCGTGTCGGAACCCGTCGCTCGAGCGGACTGCCGCGACCCTGCCGCCAGGCGTCCCGAGGACGCTCGGCCACGACCGCGACCCCAGTCAGGCGGATACCAGGAGA

Click for details-----ITS1

Click for details-----ITS2

ATCGCGTCGCTCCCCCCACACGCCCTCTCGGGCCGTGCGGGAGGGGACGGACAATGGCCTCCCGTGCTAGCGCGCGGTTGGCCTAAATGAGAGTCCCTCACGACGGGCGTCACGACAAGTGGTGGTTGAATGCCTCAACTCGCATAGCTGTCGTGTCGGAACCCGTCGCTCGAGCGGACTGCCGCGACCCTGCCTCCG

Taxonomic Information

Plant ID: NPO28245
Plant Latin Name: Strychnos Nux-Vomica
Taxonomy Genus: Strychnos
Taxonomy Family: Loganiaceae

Plant External Links:

NCBI TaxonomyDB: 28545
Plant-of-the-World-Online: 547371-1

Used in Medicines

Country/Region:

Australia; Indonesia; India; Vietnam; Jordan; Laos; Sri Lanka; Thailand

Traditional Medicine System:

Geographical Distribution

Australia; Bangladesh; Myanmar; Cuba; Indonesia; India; Cambodia; Trinidad and Tobago; Vietnam; China; Laos; Sri Lanka; Jordan; Taiwan; Thailand

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

106 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

89 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

31 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC99066

Ingredient ID: NPC96901

Ingredient ID: NPC95053

Ingredient ID: NPC88819

Ingredient ID: NPC72649

Ingredient ID: NPC71382

Ingredient ID: NPC67904

Ingredient ID: NPC67723

Ingredient ID: NPC67179

Ingredient ID: NPC66848

Ingredient ID: NPC6092

Ingredient ID: NPC6011

Ingredient ID: NPC58787

Ingredient ID: NPC49967

Ingredient ID: NPC49223

Ingredient ID: NPC4899

Ingredient ID: NPC485858

Ingredient ID: NPC485857

Ingredient ID: NPC4248

Ingredient ID: NPC37445

Ingredient ID: NPC35185

Ingredient ID: NPC326035

Ingredient ID: NPC324002

Ingredient ID: NPC323229

Ingredient ID: NPC322544

Ingredient ID: NPC322190

Ingredient ID: NPC318345

Ingredient ID: NPC31361

Ingredient ID: NPC309575

Ingredient ID: NPC306552

Ingredient ID: NPC303087

Ingredient ID: NPC302857

Ingredient ID: NPC296152

Ingredient ID: NPC284353

Ingredient ID: NPC282265

Ingredient ID: NPC279930

Ingredient ID: NPC277097

Ingredient ID: NPC277057

Ingredient ID: NPC268214

Ingredient ID: NPC26813

Ingredient ID: NPC267524

Ingredient ID: NPC2665

Ingredient ID: NPC26639

Ingredient ID: NPC266189

Ingredient ID: NPC264892

Ingredient ID: NPC263334

Ingredient ID: NPC263220

Ingredient ID: NPC261302

Ingredient ID: NPC260075

Ingredient ID: NPC258679

Ingredient ID: NPC257266

Ingredient ID: NPC255624

Ingredient ID: NPC241376

Ingredient ID: NPC236856

Ingredient ID: NPC230301

Ingredient ID: NPC22849

Ingredient ID: NPC22689

Ingredient ID: NPC226827

Ingredient ID: NPC223023

Ingredient ID: NPC221111

Ingredient ID: NPC22082

Ingredient ID: NPC22034

Ingredient ID: NPC209726

Ingredient ID: NPC208216

Ingredient ID: NPC205296

Ingredient ID: NPC205003

Ingredient ID: NPC200166

Ingredient ID: NPC197138

Ingredient ID: NPC196673

Ingredient ID: NPC186454

Ingredient ID: NPC186284

Ingredient ID: NPC181706

Ingredient ID: NPC18138

Ingredient ID: NPC181339

Ingredient ID: NPC177113

Ingredient ID: NPC168326

Ingredient ID: NPC167924

Ingredient ID: NPC167599

Ingredient ID: NPC165124

Ingredient ID: NPC165023

Ingredient ID: NPC159815

Ingredient ID: NPC156552

Ingredient ID: NPC155474

Ingredient ID: NPC152104

Ingredient ID: NPC148423

Ingredient ID: NPC147754

Ingredient ID: NPC145718

Ingredient ID: NPC142809

Ingredient ID: NPC139746

Ingredient ID: NPC139085

Ingredient ID: NPC138830

Ingredient ID: NPC138261

Ingredient ID: NPC136192

Ingredient ID: NPC127178

Ingredient ID: NPC123488

Ingredient ID: NPC123282

Ingredient ID: NPC122899

Ingredient ID: NPC122318

Ingredient ID: NPC122024

Ingredient ID: NPC121722

Ingredient ID: NPC114624

Ingredient ID: NPC10873

Ingredient ID: NPC10732

Ingredient ID: NPC10653

Ingredient ID: NPC105055

Ingredient ID: NPC102656

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Glycine receptor	GLRA1	Glycine receptor subunit alpha-1	P23415	CHEMBL5845
Therapeutic Target	Methyl-lysine/arginine binding protein	SMN1	Survival motor neuron protein	Q16637	CHEMBL1293232

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	6

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT02728349	Tolerance and Pharmacokinetic Study of Chlorogenic Acid to Advanced Glioblastoma	glioblastoma multiforme	Chlorogenic Acid (NPC302857)	NP level
NCT03751592	Phase Ib/IIa Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Advanced Lung Cancer	lung cancer	Chlorogenic Acid (NPC302857)	NP level
NCT02245204	Phase I Studies of Chlorogenic Acid for Injection for Tolerance and Pharmacokinetic of Advanced Cancers	cancer	Chlorogenic Acid (NPC302857)	NP level
NCT03758014	Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Grade IV GBM Patients	glioblastoma multiforme	Chlorogenic Acid (NPC302857)	NP level
NCT02621060	Effect of Chlorogenic Acid on Patients With Impaired Glucose Tolerance	abnormal glucose tolerance	Chlorogenic Acid (NPC302857)	NP level
NCT02136342	Phase 1 Trial of Chlorogenic Acid in Patients With Advanced Cancer	cancer	Chlorogenic Acid (NPC302857)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	F2,SMN1,AKR1B1
Unspecific body region injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND56	GLRA1,GLRB
Tonus and reflex abnormality Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB47	GLRB,GLRA1
Muscular atrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B61	SMN2,SMN1
Cerebral ischaemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B1Z	GLRB,GLRA1
Epilepsy/seizure Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A61-8A6Z	GLRA1,GLRB
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2,AKR1B1
Unspecified malignant neoplasms of unspecified sites Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D4Z	NCT02245204,NCT02136342
Glioblastoma, primary, NOS Disease Category: X.Extension Codes Disease ICD-11 Code: XH0MB1	NCT02728349,NCT03758014
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	AKR1B1,GLRB
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	GLRA1,GLRB
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	AKR1B1,GLRB
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	SMN1,AKR1B1
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	GLRA1,GLRB
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	AKR1B1,GLRB
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	AKR1B1
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	AKR1B1
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	F2
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	F2
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	AKR1B1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AKR1B1
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	F2
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	AKR1B1
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	F2
Impaired glucose tolerance Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A40.1	NCT02621060
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	NCT03751592
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	GLRB
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	GLRB
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	AKR1B1
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	AKR1B1
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	F2
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	F2
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	F2
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	F2
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	SMN1
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F2
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	F2
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	F2
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	AKR1B1
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	F2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	F2
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	GLRB
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	GLRB

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Strychnos Nux-Vomica

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

106 All known Ingredients in Total

89 Ingredients with Acceptable Bioavailablity

31 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Germ cell tumour of testis

Unspecific body region injury

Tonus and reflex abnormality

Muscular atrophy

Cerebral ischaemia

Epilepsy/seizure

Thrombosis

Unspecified malignant neoplasms of unspecified sites

Glioblastoma, primary, NOS

Carcinosarcoma of uterus

Pheochromocytoma

Malignant neoplasms of biliary tract, distal bile duct

Diffuse large B-cell lymphomas

Malignant neoplasms of thyroid gland, unspecified

Malignant neoplasms of thymus

Glaucoma

Rheumatoid arthritis

Myocardial infarction

Cardiovascular disease

Pain, unspecified

Acute diabete complication

Bleeding disorder

Ischaemic/haemorrhagic stroke

Angina pectoris

Nutritional deficiency

Type 2 diabetes mellitus

Neuropathy

Coronary thrombosis

Thrombocytopenia

Cerebral ischaemic stroke

Schizophrenia

Coagulation defect

Asthma

Cataract

Multiple sclerosis

Impaired glucose tolerance

Lung cancer

Serous cystadenoma,borderline malignancy of ovary

Osteoarthritis, unspecified

Hepatoblastoma

Leishmaniasis

Adenocarcinoma of stomach

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Squamous cell carcinoma of bronchus or lung

Adenocarcinoma of pancreas

Mesothelioma of pleura

Tetralogy of Fallot

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of kidney, except renal pelvis

Urothelial carcinoma of bladder

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Polycystic ovary syndrome

Carpal tunnel syndrome

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities