• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Polygala Amara


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GCGGAAGGATCATTGTCGAAACCTACTCGAAAGAGCGACCGTTGGACACGTATATCTTCACAGCGGGTGGACGGGTGCATGCGCTGTGCCCGTTCCACCCACAAGTAGGGCGAGGATGGCTGGGTTGGCGCTGGCCCCGCTGGGGTGCGGCTCCCTCCCTCCATTCCCGTTCCGTACTAACAACCAAACTCCGGCGCGAGAAGCGCCAAGGAAACTGTACGGACTGCGCGTGCCCCCTTTTGCCCCGGAGACGGTGCGTCGAATGGGCGCGCGCGCTGGGCATTATTTGTCGTGTAAACTGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCNACGCCTTTTTGGTTGAGGGCACGTCTGCTTGGGTGTCACGCATCGTCGCCTTCCTCGCCCTCGGCTCATCAACGGGTCGAGGTGCGTGGGGGCGGATGATGGTCTCCCGTGTGCCTCGGCACGCGGCTGGCTGAAAATCGCGGGGCCATGGTGTACAACGCCACGTCGCATGGTGGACGAGTTAATCTCTAAGACCGGACGTTTGCGCCACCTTTGCCCCCGAGACCCACCGCGCTGCGATGCAGTGCCCTCCG

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTCGCCTTCCTCGCCCTCGGCTCATCAACGGGTCGAGGTGCGTGGGGGCGGATGATGGTCTCCCGTGTGCCTCGGCACGCGGCTGGCTGAAAATCGCGGGGCCATGGTGTACAACGCCACGTCGCATGGTGGACGAGTTAATCTCTAAGACCGGACGTTTGCGCCACCTTTGCCCCCGAGACCCACCGCGCTGCGATGCAGTGCCCTCCG
Taxonomic Information

Plant ID: NPO28131
Plant Latin Name: Polygala Amara
Taxonomy Genus: Polygala
Taxonomy Family: Polygalaceae

Plant External Links:

NCBI TaxonomyDB: 58884
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Albania

Traditional Medicine System:


Medicinal Functions:

Bitter; Diaphoretic; Diuretic; Emollient; Expectorant; Galactogogue

Geographical Distribution

Albania

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

117 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


22 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

47 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98661

Ingredient ID: NPC92143

Ingredient ID: NPC91757

Ingredient ID: NPC90096

Ingredient ID: NPC88971

Ingredient ID: NPC88278

Ingredient ID: NPC87828

Ingredient ID: NPC87132

Ingredient ID: NPC87015

Ingredient ID: NPC86412

Ingredient ID: NPC86093

Ingredient ID: NPC84842

Ingredient ID: NPC82705

Ingredient ID: NPC8039

Ingredient ID: NPC73318

Ingredient ID: NPC71074

Ingredient ID: NPC708

Ingredient ID: NPC67446

Ingredient ID: NPC65823

Ingredient ID: NPC62086

Ingredient ID: NPC58575

Ingredient ID: NPC56035

Ingredient ID: NPC52021

Ingredient ID: NPC51700

Ingredient ID: NPC41961

Ingredient ID: NPC41518

Ingredient ID: NPC38203

Ingredient ID: NPC37250

Ingredient ID: NPC34338

Ingredient ID: NPC312800

Ingredient ID: NPC312553

Ingredient ID: NPC307282

Ingredient ID: NPC305464

Ingredient ID: NPC302857

Ingredient ID: NPC300351

Ingredient ID: NPC299912

Ingredient ID: NPC29641

Ingredient ID: NPC296355

Ingredient ID: NPC294906

Ingredient ID: NPC290365

Ingredient ID: NPC288956

Ingredient ID: NPC288932

Ingredient ID: NPC28811

Ingredient ID: NPC284948

Ingredient ID: NPC281254

Ingredient ID: NPC278032

Ingredient ID: NPC276610

Ingredient ID: NPC269349

Ingredient ID: NPC263548

Ingredient ID: NPC26144

Ingredient ID: NPC258892

Ingredient ID: NPC24983

Ingredient ID: NPC248222

Ingredient ID: NPC247276

Ingredient ID: NPC244398

Ingredient ID: NPC243728

Ingredient ID: NPC238811

Ingredient ID: NPC235260

Ingredient ID: NPC234617

Ingredient ID: NPC230896

Ingredient ID: NPC228633

Ingredient ID: NPC227806

Ingredient ID: NPC226141

Ingredient ID: NPC225710

Ingredient ID: NPC224389

Ingredient ID: NPC223602

Ingredient ID: NPC221435

Ingredient ID: NPC216053

Ingredient ID: NPC215624

Ingredient ID: NPC213749

Ingredient ID: NPC213572

Ingredient ID: NPC20791

Ingredient ID: NPC206095

Ingredient ID: NPC201018

Ingredient ID: NPC194842

Ingredient ID: NPC189224

Ingredient ID: NPC188591

Ingredient ID: NPC184937

Ingredient ID: NPC18074

Ingredient ID: NPC179950

Ingredient ID: NPC179114

Ingredient ID: NPC178370

Ingredient ID: NPC178134

Ingredient ID: NPC170380

Ingredient ID: NPC166625

Ingredient ID: NPC163339

Ingredient ID: NPC162742

Ingredient ID: NPC159036

Ingredient ID: NPC158371

Ingredient ID: NPC158059

Ingredient ID: NPC145667

Ingredient ID: NPC143889

Ingredient ID: NPC141855

Ingredient ID: NPC14157

Ingredient ID: NPC13818

Ingredient ID: NPC138113

Ingredient ID: NPC134835

Ingredient ID: NPC133671

Ingredient ID: NPC133404

Ingredient ID: NPC133166

Ingredient ID: NPC130278

Ingredient ID: NPC130216

Ingredient ID: NPC129088

Ingredient ID: NPC12725

Ingredient ID: NPC121788

Ingredient ID: NPC121648

Ingredient ID: NPC120625

Ingredient ID: NPC120123

Ingredient ID: NPC116775

Ingredient ID: NPC11666

Ingredient ID: NPC114239

Ingredient ID: NPC112366

Ingredient ID: NPC109821

Ingredient ID: NPC109813

Ingredient ID: NPC109731

Ingredient ID: NPC108709

Ingredient ID: NPC101744