CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Lonchocarpus Chiricanus

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TTGATGCCTCAATCAATTCGACTCGCGAACTTGTTTATACACGCGACATGGCTAGGGGCCAAAAGCCTCAGCCCCCCCCCCGCAGGGCGGGGGTCAGGCCGCACGCGTCTCCTTTTTGCCAAAACACAAACCCCGGCGCATCACGCACCAAGGAACATGAAATTGTTAACGACGTCCTCTTGAACCCGGGGACGGGGCTCCTGCGGGGGCGTCGCGACACATTATTACACAAAATGACTTTTGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACAAATGCGATACTTGGTGTGAATTGAACGCAAGTTGCGCCCGAAGCATTAGGCGAGGGCACGCCTGCCTGGGTGTCACAAATCGTTGTCCCAATGCCAACGCCTAAAAGGCCTTGTTGTCGGGGGCCATGCTGGCCTCCCGCGAGCCCCCCTTGCGGTTGGTTGAAAAACGAGTCCTCCGTGGAGAGCCCCATGATAAATGGTGGTTGAGCGACCCTCGAGACCAATCATGCGCGGCCCCTCCTCGGGCACGACTCACGCGACCCTCGCGCTCCTTCGAGCGCTCATA

Click for details-----ITS1

Click for details-----ITS2

ATCGTTGTCCCAATGCCAACGCCTAAAAGGCCTTGTTGTCGGGGGCCATGCTGGCCTCCCGCGAGCCCCCCTTGCGGTTGGTTGAAAAACGAGTCCTCCGTGGAGAGCCCCATGATAAATGGTGGTTGAGCGACCCTCGAGACCAATCATGCGCGGCCCCTCCTCGGGCACGACTCACGCGACCCTCGCGCTCCTTCGAGCGCTCATA

Taxonomic Information

Plant ID: NPO27986
Plant Latin Name: Lonchocarpus Chiricanus
Taxonomy Genus: Lonchocarpus
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 1582177
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

64 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

57 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

41 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC99240

Ingredient ID: NPC96625

Ingredient ID: NPC95427

Ingredient ID: NPC92125

Ingredient ID: NPC88955

Ingredient ID: NPC87231

Ingredient ID: NPC72452

Ingredient ID: NPC70853

Ingredient ID: NPC65920

Ingredient ID: NPC61546

Ingredient ID: NPC478527

Ingredient ID: NPC478526

Ingredient ID: NPC478525

Ingredient ID: NPC40118

Ingredient ID: NPC35836

Ingredient ID: NPC35543

Ingredient ID: NPC314268

Ingredient ID: NPC310259

Ingredient ID: NPC298093

Ingredient ID: NPC296631

Ingredient ID: NPC296556

Ingredient ID: NPC296206

Ingredient ID: NPC29353

Ingredient ID: NPC29210

Ingredient ID: NPC291044

Ingredient ID: NPC286544

Ingredient ID: NPC278556

Ingredient ID: NPC273417

Ingredient ID: NPC270617

Ingredient ID: NPC265041

Ingredient ID: NPC264160

Ingredient ID: NPC263670

Ingredient ID: NPC262094

Ingredient ID: NPC253422

Ingredient ID: NPC253352

Ingredient ID: NPC243083

Ingredient ID: NPC242895

Ingredient ID: NPC236769

Ingredient ID: NPC231410

Ingredient ID: NPC225153

Ingredient ID: NPC222342

Ingredient ID: NPC216111

Ingredient ID: NPC210809

Ingredient ID: NPC210375

Ingredient ID: NPC205093

Ingredient ID: NPC19808

Ingredient ID: NPC195360

Ingredient ID: NPC175738

Ingredient ID: NPC170011

Ingredient ID: NPC167140

Ingredient ID: NPC155550

Ingredient ID: NPC151442

Ingredient ID: NPC150648

Ingredient ID: NPC13377

Ingredient ID: NPC130130

Ingredient ID: NPC129132

Ingredient ID: NPC127447

Ingredient ID: NPC126534

Ingredient ID: NPC119725

Ingredient ID: NPC114610

Ingredient ID: NPC107240

Ingredient ID: NPC103904

Ingredient ID: NPC102639

Ingredient ID: NPC101294

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Drug Transporter	ATP-binding cassette	ABCG2	ATP-binding cassette sub-family G member 2	Q9UNQ0	CHEMBL5393
Cytochrome P450	Cytochrome P450 family 19	CYP19A1	Cytochrome P450 19A1	P11511	CHEMBL1978
Cytochrome P450	Cytochrome P450 family 2	CYP2C19	Cytochrome P450 2C19	P33261	CHEMBL3622
Therapeutic Target	Methyl-lysine/arginine binding protein	SMN1	Survival motor neuron protein	Q16637	CHEMBL1293232
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR1	Estrogen receptor alpha	P03372	CHEMBL206
Therapeutic Target	Oxidoreductase	ND4	NADH-ubiquinone oxidoreductase chain 4	P03905	CHEMBL4499
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Potassium channels	KCNA3	Voltage-gated potassium channel subunit Kv1.3	P22001	CHEMBL4633
Therapeutic Target	Protein Kinase	MTOR	Serine/threonine-protein kinase mTOR	P42345	CHEMBL2842
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR6	Serotonin 6 (5-HT6) receptor	P50406	CHEMBL3371
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Unclassified protein	PMP22	Peripheral myelin protein 22	Q01453	CHEMBL1293298

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	18

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00845819	Study of Epidermal Growth Factor on Oral Mucositis Induced by Intensive Chemotherapy for Hematologic Malignancies	oral mucositis	Nystatin (NPC314268)	NP level
NCT00674999	Use of Amnion on Partial Thickness Burns	burn	Nystatin (NPC314268)	NP level
NCT04532060	Clinical Trial Evaluating Chlorine e6 Derivative-mediated Antimicrobial Photodynamic Therapy as a Treatment for Denture Stomatitis	infection	Nystatin (NPC314268)	NP level
NCT00078559	Combination Immunosuppressive Therapy to Prevent Kidney Transplant Rejection in Adults	kidney disease	Nystatin (NPC314268)	NP level
NCT01798537	Simplified Selective Digestive Tract Decontamination for the Prevention of Intensive Care Unit Acquired Infections	bacteriemia;pneumonia	Nystatin (NPC314268)	NP level
NCT00002097	A Phase I/II Clinical Study of Nystatin I.V. (Intravenous) in Patients With HIV Infection.	HIV infection	Nystatin (NPC314268)	NP level
NCT00128323	A Comparison of Gentian Violet (GV) Mouth Washes, Nystatin, and Ketoconazole Tabs in Treating Oropharyngeal Candidiasis	oral candidiasis	Nystatin (NPC314268)	NP level
NCT01427738	Gentian Violet Vs. Nystatin Oral Suspension for Treatment of Oropharyngeal Candidiasis	HIV-1 infection	Nystatin (NPC314268)	NP level
NCT01495039	Antifungal Prophylaxis in Intensive Care Unit (ICU) Patients	candidiasis	Nystatin (NPC314268)	NP level
NCT04550546	Effects of Nystatin Suspension Oral Application on Oral Microbial Community	dental caries	Nystatin (NPC314268)	NP level
NCT02186145	Efficacy and Safety Study of Metronidazole, Nystatin and Dexamethasone Combination Therapy in Bacterial and Fungal Vaginal Infections	bacterial vaginosis;infection	Nystatin (NPC314268)	NP level
NCT04837664	Curcumin; Rose Bengal; Denture Stomatitis	nicotine dependence	Nystatin (NPC314268)	NP level
NCT00002313	A Study of Nystatin in HIV-Infected Patients	HIV infection	Nystatin (NPC314268)	NP level
NCT03862079	Fecal Transplant +/- Gut Decontamination in Preventing Acute Graft Versus Host Disease in Patients Given Broad-Spectrum Antibiotics	graft versus host disease	Nystatin (NPC314268)	NP level
NCT02059785	Phase ⅡStudy of Pinocembrin Injection to Treat Ischemic Stroke	Ischemic stroke	Pinocembrin (NPC243083)	NP level
NCT00002742	Antifungal Therapy for Fever and Neutropenia in Patients Receiving Treatment for Hematologic Cancer	chronic myeloproliferative disorder;leukemia;multiple myeloma;myelodysplastic syndrome;infection	Nystatin (NPC314268)	NP level
NCT00001812	A Randomized, Double-Blind, Placebo Controlled Trial Evaluating the Impact of Nystatin on the Development of Oral Irritation in Patients Receiving High Dose Intravenous Interleukin-2	oral candidiasis;stomatitis	Nystatin (NPC314268)	NP level
NCT01198223	Effect of Aqueous Extract of Garlic and Nystatin Mouthwash in Denture Stomatitis	denture stomatitis	Nystatin (NPC314268)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	KCNA3,LMNA,PMP22,CYP2C19,ABCG2
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	LMNA,TDP1,PMP22,SMN1
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	KCNA3,LMNA,TDP1,SMN1
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	KCNA3,MAPK1,ABCG2,SMN1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	MTOR,CYP19A1,ESR1
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	ESR1,MTOR,MAPK1
Candidosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F23	NCT00128323,NCT00001812,NCT01495039
Herpes simplex infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F00	NCT02186145,NCT00002742,NCT04532060
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	TDP1,HTR6,CYP19A1
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	TDP1,HTR6,ESR1
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	KCNA3,CYP2C19,HTR6
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	ESR1,CYP19A1
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	MTOR,ESR1
Muscular atrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B61	SMN1,SMN2
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	MTOR NCT00002742
Arteries/arterioles disorder Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD52	MTOR,MAPK1
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	MTOR,MAPK1
Human immunodeficiency virus disease without mention of associated disease or condition, clinical stage unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62.Z	NCT00002313,NCT00002097
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	KCNA3,HTR6
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA,PMP22
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CYP19A1,PMP22
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CYP19A1,HTR6
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	KCNA3,ABCG2
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CYP19A1,CYP19A1
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA,PMP22
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	CYP19A1,LMNA
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CYP19A1,LMNA
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	ESR1,HTR6
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	ABCG2
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	HTR6
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	HTR6
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	ESR1
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	MTOR
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	HTR6
Dissociative neurological symptom disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B60	HTR6
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	ESR1
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	MTOR
Skeletal anomaly Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD24	ESR1
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	ESR1
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	MTOR
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	MTOR
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	KCNA3
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	MTOR
Female infertility Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA31	ESR1
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	MTOR
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	HTR6
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	ESR1
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	ESR1
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	HTR6
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	CYP19A1
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	ESR1
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	MTOR
Male infertility Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB04	ESR1
Idiopathic inflammatory myopathy Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A41	KCNA3
Menstrual cycle bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20	ESR1
Menopausal disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA30	ESR1
Chronic myelomonocytic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A40	MTOR
Psoriatic arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA21	KCNA3
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	MTOR
Hydrocephalus Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D64	MTOR
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	MTOR
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	MTOR
Dyspareunia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA12	ESR1
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	HTR6
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	MTOR
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	ESR1
Vaginitis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA02	ESR1
Unspecified viral infection of unspecified site Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D9Z	ESR1
Adrenal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	ESR1
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CYP19A1
Pleural mesothelioma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26	MTOR
Lymphangioleiomyomatosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB07	MTOR
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	MTOR
Acquired prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E01	ESR1
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	MTOR
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	ABCG2
Female genital tract noninflammatory disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA1Y	ESR1
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	MAPK1
Metastatic tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E2Z	ESR1
Neurodegenerative disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20-8A23	HTR6
Breast in situ carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E65	ESR1
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	MTOR
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	ESR1
Disorders of oral mucosa Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA01	NCT00001812
Myeloproliferative neoplasm, NOS Disease Category: X.Extension Codes Disease ICD-11 Code: XH5HH7	NCT00002742
Burn and burn infection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND90-NE2Z	NCT00674999
Vaginal discharge Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MF3A	NCT02186145
Candidosis of lips or oral mucous membranes Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F23.0	NCT01198223
Human immunodeficiency virus type 1 Disease Category: X.Extension Codes Disease ICD-11 Code: XN8LD	NCT01427738
Graft-versus-host disease Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4B24	NCT03862079
Bacteraemia Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MA15.0	NCT01798537
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	NCT00078559
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	NCT00002742
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	NCT02059785
Pneumonia Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40	NCT01798537
Leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60-2B33	NCT00002742
Nicotine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C4A	NCT04837664
Oral mucositis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA01	NCT00845819
Dental caries Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA08.0	NCT04550546
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	ABCG2
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	KCNA3
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CYP19A1
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	CYP19A1
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	ABCG2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	HTR6
Dilated cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43.0	ABCG2
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	KCNA3
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	ESR1
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	ABCG2
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CYP19A1

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Lonchocarpus Chiricanus

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

64 All known Ingredients in Total

57 Ingredients with Acceptable Bioavailablity

41 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

Diffuse large B-cell lymphomas

Mesothelioma of pleura

Germ cell tumour of testis

Breast cancer

Solid tumour/cancer

Candidosis

Herpes simplex infection

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Cytomegaloviral disease

Endometriosis

Prostate cancer

Muscular atrophy

Multiple myeloma

Arteries/arterioles disorder

Pancreatic cancer

Human immunodeficiency virus disease without mention of associated disease or condition, clinical stage unspecified

Pheochromocytoma

Malignant neoplasms of biliary tract, distal bile duct

Hepatoblastoma

Other specified malignant neoplasms of kidney, except renal pelvis

Melanoma of skin

Hepatocellular carcinoma of liver

Superficial ovarian endometriosis

Chikungunya virus disease

Glioblastoma of brain

Carpal tunnel syndrome

Rheumatoid arthritis

Obesity

Parkinsonism

Hyper-lipoproteinaemia

Renal cell carcinoma

Anxiety

Dissociative neurological symptom disorder

Multiple sclerosis

Endometrial cancer

Skeletal anomaly

Brain cancer

Pain, unspecified

Liver cancer

Psoriasis

Pulmonary hypertension

Female infertility

Lung cancer

Mild neurocognitive disorder

Acne vulgaris

Oesophagitis

Pituitary gland disorder

Schizophrenia

Cushing syndrome

Female pelvic pain

Mature T-cell lymphoma

Male infertility

Idiopathic inflammatory myopathy

Menstrual cycle bleeding disorder

Menopausal disorder

Chronic myelomonocytic leukaemia

Psoriatic arthritis

Transplant rejection

Hydrocephalus

Malignant haematopoietic neoplasm

Malignant mesenchymal neoplasm

Dyspareunia