• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Vigna Mungo


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AGAGGTCGTTGTTGGGGGGGGTGTGCTAACAATCCGACCAGCGAATGCGTCCAAACACCCGAAGCGTCGGTTGAGGCGAGGTCTGAACGGACCCCGCCTCTTCAGGCAAAAGCCAAACCCCGGCACTCGACGTGCCAAGGATCCAAAACATATTTTTGGTCGACTTCGAAGGACAGCGTCCGACGGAATCGTCCCGAAACCAATCGAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATCGTCACCCCCATGCAAACGCGCATCGGGGCGAATGCTGACCTCCCGCGAGACACCCATCGTGGTTGGTCGAAAACCAAGGTAACGTCGGGGTCCCCCCGCAAGAAACGGTGGATGAGCAACGCTCGAGACCAATTGCGGCGACGGACACTCGGTGATCCAACGGACCGACCCTATTGCGTTCGTTGCAGATAGCAAAGACGCTCTTA

Click for details-----ITS1

AGAGGTCGTTGTTGGGGGGGGTGTGCTAACAATCCGACCAGCGAATGCGTCCAAACACCCGAAGCGTCGGTTGAGGCGAGGTCTGAACGGACCCCGCCTCTTCAGGCAAAAGCCAAACCCCGGCACTCGACGTGCCAAGGATCCAAAACATATTTTTGGTCGACTTCGAAGGACAGCGTCCGACGGAATCGTCCCGAAACCAATCGAAA

Click for details-----ITS2

ATCGTCACCCCCATGCAAACGCGCATCGGGGCGAATGCTGACCTCCCGCGAGACACCCATCGTGGTTGGTCGAAAACCAAGGTAACGTCGGGGTCCCCCCGCAAGAAACGGTGGATGAGCAACGCTCGAGACCAATTGCGGCGACGGACACTCGGTGATCCAACGGACCGACCCTATTGCGTTCGTTGCAGATAGCAAAGACGCTCTTAACGAGACCTCAGGTCAGGCGGGGCCCCCCCTTG
Taxonomic Information

Plant ID: NPO27951
Plant Latin Name: Vigna Mungo
Taxonomy Genus: Vigna
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 3915
Plant-of-the-World-Online: 525443-1

Used in Medicines

Country/Region:
Indonesia; India; Malaysia; Vietnam; Jordan; Laos

Traditional Medicine System:
Indian Folk; Unani; Ayurveda; Siddha

Geographical Distribution

Pakistan; Australia; Angola; Bangladesh; Mexico; Fiji; Tanzania; Indonesia; India; Papua New Guinea; Malaysia; Trinidad and Tobago; Vietnam; Gabon; Laos; Sri Lanka; Jordan; Nepal; Cameroon

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

97 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


57 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

62 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC90965

Ingredient ID: NPC86419

Ingredient ID: NPC85813

Ingredient ID: NPC85040

Ingredient ID: NPC83963

Ingredient ID: NPC69454

Ingredient ID: NPC62290

Ingredient ID: NPC62045

Ingredient ID: NPC55412

Ingredient ID: NPC50898

Ingredient ID: NPC49362

Ingredient ID: NPC490172

Ingredient ID: NPC489907

Ingredient ID: NPC4574

Ingredient ID: NPC4166

Ingredient ID: NPC41539

Ingredient ID: NPC39426

Ingredient ID: NPC3862

Ingredient ID: NPC34877

Ingredient ID: NPC34381

Ingredient ID: NPC328447

Ingredient ID: NPC32441

Ingredient ID: NPC317120

Ingredient ID: NPC312843

Ingredient ID: NPC311532

Ingredient ID: NPC309779

Ingredient ID: NPC305307

Ingredient ID: NPC300370

Ingredient ID: NPC29765

Ingredient ID: NPC297184

Ingredient ID: NPC294548

Ingredient ID: NPC285369

Ingredient ID: NPC282097

Ingredient ID: NPC281686

Ingredient ID: NPC279121

Ingredient ID: NPC272614

Ingredient ID: NPC270620

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC266274

Ingredient ID: NPC262094

Ingredient ID: NPC262027

Ingredient ID: NPC261831

Ingredient ID: NPC260115

Ingredient ID: NPC257756

Ingredient ID: NPC25669

Ingredient ID: NPC24923

Ingredient ID: NPC246162

Ingredient ID: NPC238122

Ingredient ID: NPC237812

Ingredient ID: NPC234510

Ingredient ID: NPC228609

Ingredient ID: NPC226453

Ingredient ID: NPC220825

Ingredient ID: NPC219876

Ingredient ID: NPC21608

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC205917

Ingredient ID: NPC203468

Ingredient ID: NPC203100

Ingredient ID: NPC202389

Ingredient ID: NPC201284

Ingredient ID: NPC199727

Ingredient ID: NPC197513

Ingredient ID: NPC192158

Ingredient ID: NPC187770

Ingredient ID: NPC187432

Ingredient ID: NPC185755

Ingredient ID: NPC184363

Ingredient ID: NPC17810

Ingredient ID: NPC177234

Ingredient ID: NPC176740

Ingredient ID: NPC174246

Ingredient ID: NPC172262

Ingredient ID: NPC170793

Ingredient ID: NPC169073

Ingredient ID: NPC167400

Ingredient ID: NPC164599

Ingredient ID: NPC156654

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC143799

Ingredient ID: NPC143005

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC134330

Ingredient ID: NPC132778

Ingredient ID: NPC126681

Ingredient ID: NPC125062

Ingredient ID: NPC122110

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111888