• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ravenia Spectabilis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAAGCCTGCCCAGCAGGGTGACCCGCGAACTAGTTAAACTGACCGGCGGGGGGATGGGCCTCGCGGTCCTCCCTCCGCCTCCGCTGCCGCGGGGAGACCCGCGGCGCGAACGAACCCCCGGCGCGGAACGCGCCAAGGAATTCTAACGGACGGGAGAGCCCGCCCCCGGGGCCTACCCGGAGGGCGGCGCCTTATCTCGCTTTGTCCCTAACGAAACAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO27873
Plant Latin Name: Ravenia Spectabilis
Taxonomy Genus: Ravenia
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 1654700
Plant-of-the-World-Online: 775020-1

Used in Medicines

Unknown.

Geographical Distribution

Jamaica; Haiti; Trinidad and Tobago; Cuba

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

16 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


8 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

10 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC76128

Ingredient ID: NPC70622

Ingredient ID: NPC63293

Ingredient ID: NPC60656

Ingredient ID: NPC44220

Ingredient ID: NPC313047

Ingredient ID: NPC312929

Ingredient ID: NPC293545

Ingredient ID: NPC282923

Ingredient ID: NPC267205

Ingredient ID: NPC254847

Ingredient ID: NPC241602

Ingredient ID: NPC211264

Ingredient ID: NPC173978

Ingredient ID: NPC164217

Ingredient ID: NPC110899