• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Clematis Flammula


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATACCTGCTCAGCAGAACGACCCGCGAACACGTGTAAAACAACCACACGCAGGGACCCTAGCGGGGACCTGCCTGCTAATCAAAATCCGGCGCRACAAGCGTCAAGGAAAACTTAGCGGAAACAAGGGGAAGGCCCGTCACAGGGACGACCCCAAGAATCCGAACACCCAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGTCTTTTAGACCGAGGGCACGTCTGCCTGGGCGTCACACACAGCGTCGCCCCCCACCAACCCGTTGGCTGGGGGACGGAAACTGGCCCCCCGAGCCCCCACGGGCACGGTCGGCACAAATGTTGGTCCTCGGCGGCGAGCGTCGCGGTCAGCGGTGGTTGTACCCCTCACCCCCCAAAGACAGAAACGACGCGCACGCCTTGCCGCACGCAGGCGCAACGAACCCAGAGAAGCCCTCCCCGGAGGGACTTTAACCTGCGACCCCAGGT

Click for details-----ITS1

NA

Click for details-----ITS2

ACAGCGTCGCCCCCCACCAACCCGTTGGCTGGGGGACGGAAACTGGCCCCCCGAGCCCCCACGGGCACGGTCGGCACAAATGTTGGTCCTCGGCGGCGAGCGTCGCGGTCAGCGGTGGTTGTACCCTCACCCCCCAAAGACAGCAACGACGCGCACGCCTCGCCGCACGCAGGCGCAGCGAACCCAGAGAAGCCCTCCCCGGAGGGACTTCAACCTGCGAC
Taxonomic Information

Plant ID: NPO2786
Plant Latin Name: Clematis Flammula
Taxonomy Genus: Clematis
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 1532743
Plant-of-the-World-Online: 709687-1

Used in Medicines

Country/Region:
Italy; Lebanon; Spain

Traditional Medicine System:

Geographical Distribution

Turkey; Afghanistan; Albania; Iran; Libya; Algeria; Pakistan; Tunisia; Italy; Lebanon; France; Portugal; Morocco; Greece; Hungary; New Zealand; Russia; Spain; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

14 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


12 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

10 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95838

Ingredient ID: NPC91896

Ingredient ID: NPC76478

Ingredient ID: NPC7560

Ingredient ID: NPC34283

Ingredient ID: NPC305542

Ingredient ID: NPC285254

Ingredient ID: NPC284967

Ingredient ID: NPC173350

Ingredient ID: NPC170333

Ingredient ID: NPC148391

Ingredient ID: NPC133156

Ingredient ID: NPC13249

Ingredient ID: NPC13007