• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Raoulia Australis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAACCCTGCAAAGCAGAACGACCCGTGAACACGTAAACACTATCGGGCAACATAGGATTGAGCTTCTGTTTGATCCTTAGTTGCCTTTGTCGATGTGCGTTCAGGACTCCTTAGAGATGAAAGGACGTCACATTGGCACACTAACCAACCCCGGCACGGAATGTGCCAAGGAAATTTTAACTTAAAGAATGGATGGTTTCATGATCTCCCGTTTTGCGGTGCGCTCATGAAACTTTACATCTTTGTAATCACAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO27849
Plant Latin Name: Raoulia Australis
Taxonomy Genus: Raoulia
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 857097
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

34 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


23 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

6 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95780

Ingredient ID: NPC88447

Ingredient ID: NPC8104

Ingredient ID: NPC78710

Ingredient ID: NPC69374

Ingredient ID: NPC40908

Ingredient ID: NPC40663

Ingredient ID: NPC34808

Ingredient ID: NPC305938

Ingredient ID: NPC285322

Ingredient ID: NPC27988

Ingredient ID: NPC26185

Ingredient ID: NPC242428

Ingredient ID: NPC236709

Ingredient ID: NPC223070

Ingredient ID: NPC220033

Ingredient ID: NPC219133

Ingredient ID: NPC218302

Ingredient ID: NPC210491

Ingredient ID: NPC203143

Ingredient ID: NPC193947

Ingredient ID: NPC190576

Ingredient ID: NPC189572

Ingredient ID: NPC182635

Ingredient ID: NPC1758

Ingredient ID: NPC175260

Ingredient ID: NPC149949

Ingredient ID: NPC14330

Ingredient ID: NPC141614

Ingredient ID: NPC13006

Ingredient ID: NPC127045

Ingredient ID: NPC107421

Ingredient ID: NPC103501

Ingredient ID: NPC102506