CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Sarracenia Flava

Example Image

PLANiTS DNA barcode

ACCTGCGGAAGGATCATTGTCGAAACCTGCCAAGCAGAACGACCCGTGAACATGTTTATTACCATTAGGGGAGTAGCTTGTTGGCCTCTTCCCATTGCCTCATACCGAGGGTGCGTTCGGATCCCTTTGGGACATCGTACTCATCCTTTGGTTGATAAATCAAAACCCGGCACGATTTGTGCCAAGGAACTGGAACAAGAGAGCACGATCATGTCCAAGCGTGTTTACATGTTTTGGGGGTTGGTGTGTCTTTTACGAAATAAAA

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO27837
Plant Latin Name: Sarracenia Flava
Taxonomy Genus: Sarracenia
Taxonomy Family: Sarraceniaceae

Plant External Links:

NCBI TaxonomyDB: 4359
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Medicinal Functions:

Hepatic; Kidney

Geographical Distribution

China

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

22 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

18 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

10 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC97278

Ingredient ID: NPC94101

Ingredient ID: NPC51959

Ingredient ID: NPC37496

Ingredient ID: NPC317224

Ingredient ID: NPC309697

Ingredient ID: NPC292747

Ingredient ID: NPC274505

Ingredient ID: NPC264317

Ingredient ID: NPC246086

Ingredient ID: NPC243728

Ingredient ID: NPC230301

Ingredient ID: NPC206432

Ingredient ID: NPC197525

Ingredient ID: NPC192638

Ingredient ID: NPC167301

Ingredient ID: NPC166845

Ingredient ID: NPC157893

Ingredient ID: NPC148757

Ingredient ID: NPC142415

Ingredient ID: NPC120840

Ingredient ID: NPC1089

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Protein Phosphatase	CDC25B	Dual specificity phosphatase Cdc25B	P30305	CHEMBL4804
Therapeutic Target	Surface antigen	F3	Coagulation factor III	P13726	CHEMBL4081

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	2

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00346502	Evaluation of 20% Betulinic Acid Ointment for Treatment of Dysplastic Nevi (Moderate to Severe Dysplasia)	dysplastic nevus	Betulinic Acid (NPC264317)	NP level
NCT00701987	Safety, Tolerability, and Preliminary Efficacy Study of ALS-357 in Patients With Cutaneous Metastatic Melanoma	melanoma	Betulinic Acid (NPC264317)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	F2,PTPN1,ACHE,AKR1B10,CES1,CYP2C19,CDC25B,PTPRC
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	ACHE,AKR1B10,F2,PTPRC
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	F2,ACHE,CDC25B,PTPRC
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	PTPN1,AKR1B10,CDC25B
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	PTPN1,ACHE,F3
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	AKR1B10,PTPRC,CDC25B
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	AKR1B10,AKR1B10,CDC25B
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	F2,ACHE,AKR1B10
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	ACHE,AKR1B10,PTPRC
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	PTPN1,F2
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F3,F2
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	AKR1B10,PTPRC
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	F2,CDC25B
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	F2,AKR1B10
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F2,F3
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	F2,CDC25B
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ACHE,CDC25B
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ACHE,CYP2C19
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE,F3
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	F2,AKR1B10
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	AKR1B10,PTPRC
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	F2
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	PTPRC
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	PTPRC
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	PTPN1
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	CDC25B
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	PTPRC
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ACHE
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	PTPRC
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	PTPN1
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	CES1
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	PTPRC
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	CES1
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	F3
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	F3
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	F2
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	ACHE
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	PTPRC
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	PTPN1
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	PTPRC
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	F2
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	ACHE
Ophthalmic devices/implants/grafts injury Disease Category: 23.External causes of morbidity or mortality Disease ICD-11 Code: PK97	PTPN1
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	F3
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	PTPN1
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	CDC25B
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	PTPN1
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Dysplastic naevus Disease Category: X.Extension Codes Disease ICD-11 Code: XH9035	NCT00346502
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	NCT00701987
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	AKR1B10
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	ACHE
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	F3
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	AKR1B10
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	AKR1B10
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	F2
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	ACHE
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	PTPRC
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	AKR1B10
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	ACHE
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	F3
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AKR1B10

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Sarracenia Flava

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

22 All known Ingredients in Total

18 Ingredients with Acceptable Bioavailablity

10 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

Other specified malignant neoplasms of kidney, except renal pelvis

Germ cell tumour of testis

Leishmaniasis

Diffuse large B-cell lymphomas

Mesothelioma of pleura

Hepatocellular carcinoma of liver

Adenocarcinoma of bronchus or lung

Malignant neoplasms of thymus

Type 2 diabetes mellitus

Bleeding disorder

Serous cystadenoma,borderline malignancy of ovary

Adenocarcinoma of stomach

Squamous cell carcinoma of bronchus or lung

Tetralogy of Fallot

Other specified malignant neoplasms ofcolon

Malignant neoplasms of oesophagus

Cytomegaloviral disease

Systemic lupus erythematosus

Malignant neoplasms of corpus uteri, unspecified

Glioblastoma of brain

Synthesis disorder

Myocardial infarction

Diffuse large B-cell lymphoma

Ischaemic/haemorrhagic stroke

Transplanted organ/tissue

Parasitic worm infestation

Acute diabete complication

Nutritional deficiency

Nasopharyngeal cancer

Transplant rejection

Myasthenia gravis

Angina pectoris

Alzheimer disease

BCR-ABL1-negative chronic myeloid leukaemia

Oesophageal/gastroduodenal disorder

Cerebral ischaemic stroke

Pediculosis

Obesity

Chronic arterial occlusive disease

Malignant haematopoietic neoplasm

Mild neurocognitive disorder

Hyper-lipoproteinaemia

Pancreatic cancer

Substance abuse

Dementia

Solid tumour/cancer

Cardiovascular disease

Parkinsonism

Coronary thrombosis

Acute myeloid leukaemia

Asthma

Breast cancer

Mature T-cell lymphoma

Multiple sclerosis

Thrombocytopenia

Pain, unspecified

Thrombosis

Glaucoma

Ophthalmic devices/implants/grafts injury

Acute respiratory distress syndrome