• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Sarracenia Flava


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

ACCTGCGGAAGGATCATTGTCGAAACCTGCCAAGCAGAACGACCCGTGAACATGTTTATTACCATTAGGGGAGTAGCTTGTTGGCCTCTTCCCATTGCCTCATACCGAGGGTGCGTTCGGATCCCTTTGGGACATCGTACTCATCCTTTGGTTGATAAATCAAAACCCGGCACGATTTGTGCCAAGGAACTGGAACAAGAGAGCACGATCATGTCCAAGCGTGTTTACATGTTTTGGGGGTTGGTGTGTCTTTTACGAAATAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO27837
Plant Latin Name: Sarracenia Flava
Taxonomy Genus: Sarracenia
Taxonomy Family: Sarraceniaceae

Plant External Links:

NCBI TaxonomyDB: 4359
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Hepatic; Kidney

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

22 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


18 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

10 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97278

Ingredient ID: NPC94101

Ingredient ID: NPC51959

Ingredient ID: NPC37496

Ingredient ID: NPC317224

Ingredient ID: NPC309697

Ingredient ID: NPC292747

Ingredient ID: NPC274505

Ingredient ID: NPC264317

Ingredient ID: NPC246086

Ingredient ID: NPC243728

Ingredient ID: NPC230301

Ingredient ID: NPC206432

Ingredient ID: NPC197525

Ingredient ID: NPC192638

Ingredient ID: NPC167301

Ingredient ID: NPC166845

Ingredient ID: NPC157893

Ingredient ID: NPC148757

Ingredient ID: NPC142415

Ingredient ID: NPC120840

Ingredient ID: NPC1089