• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Cirsium Brevistylum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

GTGAACTGCGGAAGGATCATTGTCGAAGCCTGCACAGCAGAACGACCCGTGGACACGTAATCACAGCCGGGCGTCGAGGGGGTCGGGCGTCAGCCCGGTCCCTGCGATGCTCGTCGACGTGCGTCTGCGATGCCTCGTTTCGAGGCGTCGTGGATGTTGCGTCGGCACCTAAACAAACCCCGGCACGGCATGTGCCAAGGAAAACAAAACATAGGAAGGGCGCGTCCCGTGTTGCCCCGTTCGCGGTGTGCGCACGGGCCGTGGCCTCTCAATAACCATAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO2777
Plant Latin Name: Cirsium Brevistylum
Taxonomy Genus: Cirsium
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 196706
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

30 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


17 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

14 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC69355

Ingredient ID: NPC59581

Ingredient ID: NPC51700

Ingredient ID: NPC4574

Ingredient ID: NPC34786

Ingredient ID: NPC313108

Ingredient ID: NPC309618

Ingredient ID: NPC295295

Ingredient ID: NPC292009

Ingredient ID: NPC28779

Ingredient ID: NPC285934

Ingredient ID: NPC279959

Ingredient ID: NPC2710

Ingredient ID: NPC270913

Ingredient ID: NPC238205

Ingredient ID: NPC236579

Ingredient ID: NPC224651

Ingredient ID: NPC210108

Ingredient ID: NPC20434

Ingredient ID: NPC20117

Ingredient ID: NPC19841

Ingredient ID: NPC170448

Ingredient ID: NPC164576

Ingredient ID: NPC162202

Ingredient ID: NPC161202

Ingredient ID: NPC158481

Ingredient ID: NPC153783

Ingredient ID: NPC144419

Ingredient ID: NPC128061

Ingredient ID: NPC116368