CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Idesia Polycarpa

Example Image

PLANiTS DNA barcode

Click for details-----ITS

GTGAACTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAACGACCCGCGAACCCGTGGCATGACACGCTGGGCTCGGGGGGCACCCGCCCCTTCGCGTCCTCACGGGCCGTGGAGGGACGCATCTGCGCCCAACGCGGCTCGCCAACGAACCCCGGCGCGAGAAGCGCCAAGGAACTTGAGTACTGGGAGCACGCCCTCGTAGCCTCGGAGACGGGGGCGCGTCTTCTTTTTGTGACAAGCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTCATGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGCCCCCGCACCCCTCGTCTCGCGAGGGCAGGGGCGGATACTGGCCTCCCGCGCGCTTCCGCTCGCGGTTGGCCCAAAATCGAGTCCTCGGCGACGATCGCCACGACGAGCGGTGGTTGAGAGACCCTCGGACACGGTCGTGCGCGCTCCTGTCGCCCTCGGGACCTCCTGGACCCTCGGGCATCTGCTTTATGGGATGCTCTCG

Click for details-----ITS1

Click for details-----ITS2

ATCGTCGCCCCCGCACCCCTCGTCTCGCGAGGGCAGGGGCGGATACTGGCCTCCCGCGCGCTTCCGCTCGCGGTTGGCCCAAAATCGAGTCCTCGGCGACGATCGCCACGACGAGCGGTGGTTGAGAGACCCTCGGACACGGTCGTGCGCGCTCCTGTCGCCCTCGGGACCTCCTGGACCCTCGGGCATCTGCTTTATGGGATGCTCTCG

Taxonomic Information

Plant ID: NPO27632
Plant Latin Name: Idesia Polycarpa
Taxonomy Genus: Idesia
Taxonomy Family: Salicaceae

Plant External Links:

NCBI TaxonomyDB: 77057
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

4 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

11 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC87696

Ingredient ID: NPC474422

Ingredient ID: NPC471214

Ingredient ID: NPC471157

Ingredient ID: NPC471156

Ingredient ID: NPC40377

Ingredient ID: NPC30563

Ingredient ID: NPC253746

Ingredient ID: NPC166168

Ingredient ID: NPC141765

Ingredient ID: NPC129909

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Isomerase	TOP1	DNA topoisomerase I	P11387	CHEMBL1781
Therapeutic Target	Lyase	CA1	Carbonic anhydrase I	P00915	CHEMBL261
Therapeutic Target	Lyase	CA2	Carbonic anhydrase II	P00918	CHEMBL205
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Lyase	CA14	Carbonic anhydrase XIV	Q9ULX7	CHEMBL3510
Therapeutic Target	Lyase	CA9	Carbonic anhydrase IX	Q16790	CHEMBL3594
Therapeutic Target	Methyl-lysine/arginine binding protein	SMN1	Survival motor neuron protein	Q16637	CHEMBL1293232
Therapeutic Target	Phosphodiesterase	TDP2	Tyrosyl-DNA phosphodiesterase 2	O95551	CHEMBL2169736
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Protein Kinase	MTOR	Serine/threonine-protein kinase mTOR	P42345	CHEMBL2842
Therapeutic Target	Protein Kinase	CHEK1	Serine/threonine-protein kinase Chk1	O14757	CHEMBL4630
Therapeutic Target	Secreted protein	THPO	Thrombopoietin	P40225	CHEMBL1293256
Therapeutic Target	Secreted protein	HBB	Hemoglobin beta chain	P68871	CHEMBL4331
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR2B	Serotonin 2b (5-HT2b) receptor	P41595	CHEMBL1833
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transcription factor	HIF1A	Hypoxia-inducible factor 1 alpha	Q16665	CHEMBL4261
Therapeutic Target	Transcription factor	TP53	Cellular tumor antigen p53	P04637	CHEMBL4096
Therapeutic Target	Unclassified protein	GMNN	Geminin	O75496	CHEMBL1293278
Therapeutic Target	Unclassified protein	PMP22	Peripheral myelin protein 22	Q01453	CHEMBL1293298

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	HIF1A,TP53,CA9,CHEK1,SSTR3,GMNN,PMP22,LMNA
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	SMN1,CA9,CA12,TOP1,SSTR3,GMNN,CA7,LMNA
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	HIF1A,SMN1,RAB9A,CA12,CHEK1,TOP1,GMNN,CA14
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	MTOR,CA2,CA14,CA1,CA9,TOP1,CA12
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	TP53,CA9,CA2,TOP1,GMNN,CA7,CA14
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA1,HBB,CA12,CHEK1,SSTR3,GMNN,PMP22
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	THPO,CA9,CA12,CHEK1,HTR2B,GMNN,CA7
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	TP53,CA9,CA12,CHEK1,CA2,GMNN
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	RAB9A,CA9,CA12,CA2,GMNN,LMNA
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA9,CA12,CHEK1,SSTR3,GMNN,CA7
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	HIF1A,MTOR,TOP1,CHEK1,CA9
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA9,CA12,CHEK1,GMNN,CA7
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA12,CA14,CA2,TOP1
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	PMP22,CA2,LMNA,RAB9A
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	THPO,CA2,CA14,CA1
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	THPO,CA9,CA12,CHEK1
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	TP53,CHEK1,TOP1
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA1,CA2,CA12
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	TP53,HIF1A,TOP1
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	MTOR,CA9,TOP1
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	TOP1,MTOR,CHEK1
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	HIF1A,HTR2B,MTOR
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	TP53,CHEK1,MTOR
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	MTOR,TP53,CHEK1
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	CA2,SSTR3,CA14
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CA9,CA9,CA1
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CA9,CHEK1,CA2
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	SSTR3,CA12,CA7
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CA9,CHEK1,CA2
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	THPO,HBB,HTR2B
Esophageal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	TP53,TOP1
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	CA2,CA1
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	TP53,MTOR
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	MTOR,TP53
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	CA2,CA1
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	TP53,TOP1
Duodenal ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA63	CA1,CA2
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	MTOR,TP53
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	TOP1,TP53
Muscular atrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B61	SMN1,SMN2
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	MTOR,TP53
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	TOP1,TP53
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12,HBB
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA9,CA12
Malignant neoplasms of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	HBB,CA1
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	HIF1A,LMNA
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CA9,GMNN
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA12,CA2
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	HBB,CA1
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	THPO,TP53,SMN1,CA9,CA12,CHEK1,SSTR3,HTR2B,GMNN,PMP22,LMNA
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	TP53,CA9,CA1,CA2,CHEK1,CA12,HIF1A,TOP1,CA14,MTOR
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	HIF1A,CA9,CHEK1,CA2,TOP1,HTR2B,PMP22,CA7,CA14,LMNA
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA9,CA12,CHEK1,SSTR3,GMNN,CA9,CA12,CHEK1,SSTR3,GMNN
Ovarian dysfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80	TP53
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	CA2
Sickle-cell disorder Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A51	HBB
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	MTOR
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	MTOR
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	HTR2B
Lip/oral cavity/pharynx neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6E	TP53
Kidney failure Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB60-GB6Z	TP53
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	MTOR
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	CA2
Liposarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B59	TP53
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	MTOR
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	THPO
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	TP53
Anal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C00	CHEK1
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	TOP1
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CA2
Pleural mesothelioma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26	MTOR
Thalassaemia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A50	HBB
Lymphangioleiomyomatosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB07	MTOR
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	HTR2B
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	TP53
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	TP53
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	THPO
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	MTOR
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	HTR2B
Hydrocephalus Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D64	MTOR
Inborn metabolism deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5C59	CA14
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	MTOR
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	TP53
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	TP53
Arteries/arterioles disorder Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD52	MTOR
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	MTOR
Human immunodeficiency virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C60-1C62	TOP1
Hodgkin lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B30	CHEK1
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	CA2
Chronic myelomonocytic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A40	MTOR
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	SSTR3
Metastatic liver/bile duct neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D80	TP53
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	RAB9A
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	HTR2B
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	TOP1
Adrenomedullary hyperfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A75	HIF1A
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	TP53
Non-alcoholic steatohepatitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92.1	HBB
Hypertrophic cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43.1	HBB
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	SSTR3
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CHEK1
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	CA9
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	HBB
Pre-eclampsia Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA24	CA1
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	CA14
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CA9
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	SSTR3
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	CHEK1
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CA9

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Idesia Polycarpa

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

11 All known Ingredients in Total

4 Ingredients with Acceptable Bioavailablity

11 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Malignant neoplasms of biliary tract, distal bile duct

Mesothelioma of pleura

Germ cell tumour of testis

Breast cancer

Carcinosarcoma of uterus

Hepatoblastoma

Adenocarcinoma of bronchus or lung

Serous cystadenoma,borderline malignancy of ovary

Glioblastoma of brain

Malignant neoplasms of adrenal gland

Mature T-cell lymphoma

Squamous cell carcinoma of bronchus or lung

Bacterial infection

Superficial ovarian endometriosis

Cytomegaloviral disease

Invasive carcinoma of breast

Ovarian cancer

Seborrhoeic dermatitis

Brain cancer

Renal cell carcinoma

Lung cancer

Pulmonary hypertension

Pancreatic cancer

Head and neck cancer

Pheochromocytoma

Other specified malignant neoplasms of kidney, except renal pelvis

Urothelial carcinoma of bladder

Malignant neoplasms of thyroid gland, unspecified

Malignant neoplasms of corpus uteri, unspecified

Carpal tunnel syndrome

Esophageal cancer

Glaucoma

Endometrial cancer

Transplant rejection

Rheumatoid arthritis

Stomach cancer

Duodenal ulcer

Malignant haematopoietic neoplasm

Myelodysplastic syndrome

Muscular atrophy

Bladder cancer

Colorectal cancer

Osteoarthritis, unspecified

Other specified malignant neoplasms of bronchus or lung

Malignant neoplasms of stomach

Chikungunya virus disease

Malignant neoplasms of thymus

Renal cell carcinoma, chromophobe type

Lyme borreliosis

Diffuse large B-cell lymphomas

Solid tumour/cancer

Adenocarcinoma of pancreas

Hepatocellular carcinoma of liver

Ovarian dysfunction

Heart failure

Sickle-cell disorder

Prostate cancer

Pleomorphic sarcoma

Psychotic disorder

Lip/oral cavity/pharynx neoplasm

Kidney failure

Multiple myeloma

Essential hypertension

Liposarcoma