• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Camptothecium Lutescens


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TGCACACACAAGTTGCAGCCAACCCGCGGCGAACGAACACATTGTCCCCCTTCGGCGGGTCGTGGCGCCTCGCGGCGTCGCGGCCGGCCGTCTCCCCTCGTCACGAGCGCGAGCTTCGTGGCGTCGGGTTTCCACACGATGCATCACCCGAACGACTGAGTCCCGAATACTTGGATGGAGGAGTGGGCGCGTTTCCCCGTCCCCTTGAGCGAGCGGGCTTGCTTGCGAACTCGAGRGGCGCGGCGCGCGCCRGYTACCTTACGACGAGTTGAAACATAATAAAAAA

Click for details-----ITS2

CSCCCCCCCCCCGATCCACTCTCSCCKCGAGGCGCCAGTCSGGTCGAGTGCAAGKGGCCGKCCCGGKGGAGCGGGCCTCCTTTCKCGAGGAGGCCTHGACTTMGAAGGGTCGGCTGAAATGGATGGAATCGGGCCGCCGTGGTGACACAGTCCGCGATCGGGTGATTTYGTCGCGAGGCTCCTTCGGGAGGTTCTCGGCGAATTTTTTMTAAGTGCTTGGCTGCGTCCCCCAGTTGGCTCGGGTTACCTCATGCAGGTCGAGCGCGCCCCCGCGGCGCGCGTCACGCATCAGACCTCTAATCGGAAAA
Taxonomic Information

Plant ID: NPO27437
Plant Latin Name: Camptothecium Lutescens
Taxonomy Genus: Camptothecium
Taxonomy Family: Brachytheciaceae

Plant External Links:

NCBI TaxonomyDB: 184650
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

54 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


48 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

24 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC988

Ingredient ID: NPC93241

Ingredient ID: NPC93016

Ingredient ID: NPC9296

Ingredient ID: NPC88497

Ingredient ID: NPC87517

Ingredient ID: NPC86944

Ingredient ID: NPC84786

Ingredient ID: NPC84592

Ingredient ID: NPC82784

Ingredient ID: NPC77000

Ingredient ID: NPC70867

Ingredient ID: NPC70448

Ingredient ID: NPC56433

Ingredient ID: NPC55211

Ingredient ID: NPC5413

Ingredient ID: NPC44276

Ingredient ID: NPC309056

Ingredient ID: NPC303838

Ingredient ID: NPC299094

Ingredient ID: NPC295614

Ingredient ID: NPC295317

Ingredient ID: NPC281398

Ingredient ID: NPC270476

Ingredient ID: NPC267948

Ingredient ID: NPC267076

Ingredient ID: NPC260323

Ingredient ID: NPC256063

Ingredient ID: NPC254166

Ingredient ID: NPC252329

Ingredient ID: NPC250323

Ingredient ID: NPC241779

Ingredient ID: NPC239185

Ingredient ID: NPC234248

Ingredient ID: NPC221992

Ingredient ID: NPC21046

Ingredient ID: NPC210216

Ingredient ID: NPC188523

Ingredient ID: NPC18074

Ingredient ID: NPC1786

Ingredient ID: NPC177267

Ingredient ID: NPC176130

Ingredient ID: NPC156654

Ingredient ID: NPC155790

Ingredient ID: NPC146416

Ingredient ID: NPC142415

Ingredient ID: NPC123581

Ingredient ID: NPC118210

Ingredient ID: NPC117674

Ingredient ID: NPC116697

Ingredient ID: NPC113917

Ingredient ID: NPC106986

Ingredient ID: NPC103480

Ingredient ID: NPC10051