• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ribes Sanguineum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATACCTGCCTAGCAGAACGACCCGTGAACACGTACTTAWCAACGGGGGTCGGGGGCGGGCATCACATGTCCGTCCCTCTCCCCCCTCTGCCGGGTTGTGCTCGGTTTTCGCACTGTCTTTCGAGATGGTGTCGCGACCGTGCGCTCCCGGCAAACACAACGAACCCCGGCGTGAATTGCGCCAAGGAAATATAAAAGAAGGATCATGTCCCCGGCACCTTCGTGTCGGACCAGGGCGTGTCATCTTTGATGTCTTTAACGACTCTCGGCAACGGATATCTCGGCTCTCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTCGGCCGAAGGCACGTCTGCCTGGGCGTCACGTACCCAATCGCTCCCCAAAACCTTCCCACATTTCTACCGACTTGTGGAGGGCTCGGAGGGCGGAGATTGGCCTCCCGTGCCGTAACGGCGCGGATGGCCTAAAAGCAAAGCATCGAGCGACGAAACGTCACGACAAGTGGTGGTTGATAAAGCCCTAGCGGCAGCCTCATCGTGTCGTGTGCGTCCAGTCGCGTTCGATCGCTGAACGACCCCTACACGTCTCGACGAATTCTGTCGCGA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO2741
Plant Latin Name: Ribes Sanguineum
Taxonomy Genus: Ribes
Taxonomy Family: Grossulariaceae

Plant External Links:

NCBI TaxonomyDB: 175201
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

74 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


60 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

16 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99952

Ingredient ID: NPC99664

Ingredient ID: NPC96855

Ingredient ID: NPC93590

Ingredient ID: NPC78870

Ingredient ID: NPC74214

Ingredient ID: NPC71945

Ingredient ID: NPC70479

Ingredient ID: NPC52836

Ingredient ID: NPC51700

Ingredient ID: NPC50898

Ingredient ID: NPC49158

Ingredient ID: NPC48831

Ingredient ID: NPC47616

Ingredient ID: NPC42960

Ingredient ID: NPC39619

Ingredient ID: NPC38707

Ingredient ID: NPC32581

Ingredient ID: NPC310580

Ingredient ID: NPC306381

Ingredient ID: NPC304721

Ingredient ID: NPC304669

Ingredient ID: NPC30168

Ingredient ID: NPC300492

Ingredient ID: NPC299174

Ingredient ID: NPC299135

Ingredient ID: NPC290527

Ingredient ID: NPC290328

Ingredient ID: NPC28751

Ingredient ID: NPC285371

Ingredient ID: NPC272736

Ingredient ID: NPC260265

Ingredient ID: NPC255565

Ingredient ID: NPC253619

Ingredient ID: NPC253171

Ingredient ID: NPC252531

Ingredient ID: NPC251708

Ingredient ID: NPC246903

Ingredient ID: NPC245344

Ingredient ID: NPC243702

Ingredient ID: NPC230332

Ingredient ID: NPC229943

Ingredient ID: NPC228346

Ingredient ID: NPC224543

Ingredient ID: NPC222001

Ingredient ID: NPC219862

Ingredient ID: NPC210293

Ingredient ID: NPC201602

Ingredient ID: NPC19900

Ingredient ID: NPC196499

Ingredient ID: NPC194297

Ingredient ID: NPC191617

Ingredient ID: NPC18873

Ingredient ID: NPC18727

Ingredient ID: NPC187151

Ingredient ID: NPC183191

Ingredient ID: NPC1786

Ingredient ID: NPC177114

Ingredient ID: NPC176829

Ingredient ID: NPC17091

Ingredient ID: NPC167931

Ingredient ID: NPC165418

Ingredient ID: NPC15889

Ingredient ID: NPC156705

Ingredient ID: NPC15622

Ingredient ID: NPC153340

Ingredient ID: NPC14508

Ingredient ID: NPC136030

Ingredient ID: NPC135808

Ingredient ID: NPC116595

Ingredient ID: NPC116467

Ingredient ID: NPC110228

Ingredient ID: NPC107473

Ingredient ID: NPC104195