• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Citrus Tangerina


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

CAGCAGACGACCCGCGACCAGTTGATATCACCGGCGGCGGGAGGGGGTGGACGCGTCCGCAACGGGCGCTCCTCCTTCCCGCCCCATGCCGCGGGGAGAGGGACTCGTCCCGCTCCCGGCTGGCGAAACAACGAACCCCCGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCTCCCGCGGCCCCGGAGACGGTGCGCCGCGGGGTGCGGCGCCTTCTTTCACATGTATCCAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO27312
Plant Latin Name: Citrus Tangerina
Taxonomy Genus: Citrus
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 237575
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

45 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


18 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

29 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98543

Ingredient ID: NPC81010

Ingredient ID: NPC7551

Ingredient ID: NPC75034

Ingredient ID: NPC70744

Ingredient ID: NPC62382

Ingredient ID: NPC53545

Ingredient ID: NPC49074

Ingredient ID: NPC38684

Ingredient ID: NPC37250

Ingredient ID: NPC33054

Ingredient ID: NPC312800

Ingredient ID: NPC312103

Ingredient ID: NPC300326

Ingredient ID: NPC300017

Ingredient ID: NPC29883

Ingredient ID: NPC29799

Ingredient ID: NPC294902

Ingredient ID: NPC289774

Ingredient ID: NPC287046

Ingredient ID: NPC281131

Ingredient ID: NPC279121

Ingredient ID: NPC272026

Ingredient ID: NPC258236

Ingredient ID: NPC245437

Ingredient ID: NPC225710

Ingredient ID: NPC219876

Ingredient ID: NPC209846

Ingredient ID: NPC20791

Ingredient ID: NPC190299

Ingredient ID: NPC189142

Ingredient ID: NPC186917

Ingredient ID: NPC18578

Ingredient ID: NPC183950

Ingredient ID: NPC179950

Ingredient ID: NPC176740

Ingredient ID: NPC174789

Ingredient ID: NPC169210

Ingredient ID: NPC146689

Ingredient ID: NPC137949

Ingredient ID: NPC117418

Ingredient ID: NPC116391

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC100551