CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Citrus Tangerina

Example Image

PLANiTS DNA barcode

CAGCAGACGACCCGCGACCAGTTGATATCACCGGCGGCGGGAGGGGGTGGACGCGTCCGCAACGGGCGCTCCTCCTTCCCGCCCCATGCCGCGGGGAGAGGGACTCGTCCCGCTCCCGGCTGGCGAAACAACGAACCCCCGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCTCCCGCGGCCCCGGAGACGGTGCGCCGCGGGGTGCGGCGCCTTCTTTCACATGTATCCAAAA

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO27312
Plant Latin Name: Citrus Tangerina
Taxonomy Genus: Citrus
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 237575
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

45 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

18 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

29 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC98543

Ingredient ID: NPC81010

Ingredient ID: NPC7551

Ingredient ID: NPC75034

Ingredient ID: NPC70744

Ingredient ID: NPC62382

Ingredient ID: NPC53545

Ingredient ID: NPC49074

Ingredient ID: NPC38684

Ingredient ID: NPC37250

Ingredient ID: NPC33054

Ingredient ID: NPC312800

Ingredient ID: NPC312103

Ingredient ID: NPC300326

Ingredient ID: NPC300017

Ingredient ID: NPC29883

Ingredient ID: NPC29799

Ingredient ID: NPC294902

Ingredient ID: NPC289774

Ingredient ID: NPC287046

Ingredient ID: NPC281131

Ingredient ID: NPC279121

Ingredient ID: NPC272026

Ingredient ID: NPC258236

Ingredient ID: NPC245437

Ingredient ID: NPC225710

Ingredient ID: NPC219876

Ingredient ID: NPC209846

Ingredient ID: NPC20791

Ingredient ID: NPC190299

Ingredient ID: NPC189142

Ingredient ID: NPC186917

Ingredient ID: NPC18578

Ingredient ID: NPC183950

Ingredient ID: NPC179950

Ingredient ID: NPC176740

Ingredient ID: NPC174789

Ingredient ID: NPC169210

Ingredient ID: NPC146689

Ingredient ID: NPC137949

Ingredient ID: NPC117418

Ingredient ID: NPC116391

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC100551

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Therapeutic Target	Enzyme	ALOX12	Arachidonate 12-lipoxygenase	P18054	CHEMBL3687
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Enzyme	NOX4	NADPH oxidase 4	Q9NPH5	CHEMBL1250375
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Lyase	CA1	Carbonic anhydrase I	P00915	CHEMBL261
Therapeutic Target	Lyase	CA14	Carbonic anhydrase XIV	Q9ULX7	CHEMBL3510
Therapeutic Target	Lyase	CA9	Carbonic anhydrase IX	Q16790	CHEMBL3594
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA2	Carbonic anhydrase II	P00918	CHEMBL205
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Lyase	CA4	Carbonic anhydrase IV	P22748	CHEMBL3729
Therapeutic Target	Lysine demethylase	KDM4E	Lysine-specific demethylase 4D-like	B2RXH2	CHEMBL1293226
Therapeutic Target	Metallo protease	MMP12	Matrix metalloproteinase 12	P39900	CHEMBL4393
Therapeutic Target	Metallo protease	MMP9	Matrix metalloproteinase 9	P14780	CHEMBL321
Therapeutic Target	Metallo protease	MMP1	Matrix metalloproteinase-1	P03956	CHEMBL332
Therapeutic Target	Metallo protease	MMP2	Matrix metalloproteinase-2	P08253	CHEMBL333
Therapeutic Target	Oxidoreductase	HSD17B10	Endoplasmic reticulum-associated amyloid beta-peptide-binding protein	Q99714	CHEMBL4159
Therapeutic Target	Peptide receptor (family A GPCR)	NPSR1	Neuropeptide S receptor	Q6W5P4	CHEMBL5162
Therapeutic Target	Protein Kinase	AXL	Tyrosine-protein kinase receptor UFO	P30530	CHEMBL4895
Therapeutic Target	Protein Kinase	KDR	Vascular endothelial growth factor receptor 2	P35968	CHEMBL279
Therapeutic Target	Protein Kinase	IGF1R	Insulin-like growth factor I receptor	P08069	CHEMBL1957
Therapeutic Target	Protein Kinase	MKNK2	MAP kinase signal-integrating kinase 2	Q9HBH9	CHEMBL4204
Therapeutic Target	Protein Kinase	YES1	Tyrosine-protein kinase YES	P07947	CHEMBL2073
Therapeutic Target	Protein Kinase	MKNK1	MAP kinase-interacting serine/threonine-protein kinase MNK1	Q9BUB5	CHEMBL4718
Therapeutic Target	Protein Kinase	FLT3	Tyrosine-protein kinase receptor FLT3	P36888	CHEMBL1974
Therapeutic Target	Protein Kinase	CDK1	Cyclin-dependent kinase 1	P06493	CHEMBL308
Therapeutic Target	Protein Kinase	AURKB	Serine/threonine-protein kinase Aurora-B	Q96GD4	CHEMBL2185
Therapeutic Target	Protein Kinase	PIM1	Serine/threonine-protein kinase PIM1	P11309	CHEMBL2147
Therapeutic Target	Protein Kinase	MET	Hepatocyte growth factor receptor	P08581	CHEMBL3717
Therapeutic Target	Serine protease	DPP4	Dipeptidyl peptidase IV	P27487	CHEMBL284
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD1	Dopamine D1 receptor	P21728	CHEMBL2056
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transcription factor	HIF1A	Hypoxia-inducible factor 1 alpha	Q16665	CHEMBL4261
Therapeutic Target	Transcription factor	NFKB1	Nuclear factor NF-kappa-B p105 subunit	P19838	CHEMBL3251
Therapeutic Target	Transferase	FUT7	Alpha-(1,3)-fucosyltransferase 7	Q11130	CHEMBL3596077
Therapeutic Target	Unclassified protein	SNCA	Alpha-synuclein	P37840	CHEMBL6152

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	59

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01839344	Effects of Quercetin on Blood Sugar and Blood Vessel Function in Type 2 Diabetes.	type 2 diabetes mellitus	Quercetin (NPC20791)	NP level
NCT01294462	Study to Assess Safety and Efficacy of Ticagrelor (AZD6140) Versus Clopidogrel in Asian/Japanese Patients With Non-ST or ST Elevation Acute Coronary Syndromes (ACS)	acute coronary syndrome	Salicylic Acid (NPC100551)	NP level
NCT01914627	Parallel Group Trial to Evaluate the Efficacy and Safety of Loion® Compared to 10% Salicylic Acid in Patients With Chronic Psoriasis Capitis	psoriasis	Salicylic Acid (NPC100551)	NP level
NCT02524665	8 Week Study to Evaluate and Compare the Efficacy and Tolerability of MAXCLARITY II and MURAD To Treat Acne	acne	Salicylic Acid (NPC100551)	NP level
NCT01004705	A Pharmacodynamic Study to Evaluate the Effect of a Fixed Dose Combination Pill on Low Density Lipoprotein (LDL) Cholesterol	Hypercholesterolemia	Salicylic Acid (NPC100551)	NP level
NCT01012349	Efficacy and Safety Clinical Trial of the Combination of Acetylsalicylic Acid, Sodium Bicarbonate and Citric Acid, Produced by Geolab Pharmaceutical Industries Ltd., Compared to Acetylsalicylic Acid (Aspirin ® - Bayer) in Patients With Episodic Tension-type Headache.	Tension-type headache	Salicylic Acid (NPC100551)	NP level
NCT02313909	Rivaroxaban Versus Aspirin in Secondary Prevention of Stroke and Prevention of Systemic Embolism in Patients With Recent Embolic Stroke of Undetermined Source (ESUS)	stroke	Salicylic Acid (NPC100551)	NP level
NCT04474626	Isoquercetin in Sickle Cell Anemia	sickle cell anemia	Isoquercetin (NPC179950)	NP level
NCT00501254	Pharmacodynamic Trial, of Slow Release ASA, in Platelet Functionalism, a Long Term Treatment Period	cardiovascular disease	Salicylic Acid (NPC100551)	NP level
NCT04733534	An Open-Label Intervention Trial to Reduce Senescence and Improve Frailty in Adult Survivors of Childhood Cancer	childhood cancer	Quercetin (NPC20791)	NP level
NCT04946383	Safety and Effectivness of Quercetin & Dasatinib on Epigenetic Aging	aging	Quercetin (NPC20791)	NP level
NCT01348204	Nasal Potential Studies Utilizing Cystic Fibrosis Transmembrane Regulator (CFTR) Modulators	cystic fibrosis	Quercetin (NPC20791)	NP level
NCT04907253	Quercetin in Coronary Artery By-pass Surgery	coronary artery disease	Quercetin (NPC20791)	NP level
NCT02351622	Caffeic Acid Tablets as a Second-line Therapy for ITP	autoimmune thrombocytopenic purpura	Caffeic Acid (NPC294902)	NP level
NCT01375101	Therapeutic Effect of Quercetin and the Current Treatment of Erosive and Atrophic Oral Lichen Planus	oral lichen planus	Quercetin (NPC20791)	NP level
NCT04851821	The Effectiveness of Phytotherapy in SARS-COV2(COVID-19)	COVID-19	Quercetin (NPC20791)	NP level
NCT01552798	Efficacy of a Single Dose of Aspirin vs. Acetaminophen in Tension Type Headache	Headache	Salicylic Acid (NPC100551)	NP level
NCT02352987	Effect of Neem Extract, Propylene Glycol and Salicylic Acid Combination in the Treatment of Arsenical Palmar Keratosis	heavy metal poisoning	Salicylic Acid (NPC100551)	NP level
NCT04514510	Fixed Dose Flavonoid Isoquercetin on Thrombo-Inflammatory Biomarkers in Subjects With Stable Sickle Cell Disease	sickle cell anemia	Isoquercetin (NPC179950)	NP level
NCT05422885	Safety and Feasibility of Dasatinib and Quercetin in Adults at Risk for Alzheimer's Disease	aging	Quercetin (NPC20791)	NP level
NCT05456022	Therapeutic Efficacy of Quercetin Versus Its Encapsulated Nanoparticle on Tongue Squamous Cell Carcinoma Cell Line	mouth neoplasm	Quercetin (NPC20791)	NP level
NCT03056703	Bioequivalence of Single Dose Fast Release Aspirin (1000 mg) Tablet Versus Single Dose of Two 500 mg Fast Release Aspirin Tablets	pain	Salicylic Acid (NPC100551)	NP level
NCT01708278	Beneficial Effects of Quercetin in Chronic Obstructive Pulmonary Disease (COPD)	chronic obstructive pulmonary disease	Quercetin (NPC20791)	NP level
NCT01438320	Q-Trial in Patients With Hepatitis C	chronic hepatitis C virus infection	Quercetin (NPC20791)	NP level
NCT00361322	Efficacy and Safety of a Preparation Containing an Antibiotic and Anti-Inflammatory Agent in Acne Vulgaris	acne	Salicylic Acid (NPC100551)	NP level
NCT01046942	ThrombElastoGraphic Haemostatic Status and Antiplatelet Therapy After Coronary Artery Bypass Graft Surgery	thrombophilia;thrombotic disease	Salicylic Acid (NPC100551)	NP level
NCT02552888	Nitrite, Isoquercetin and Endothelial Dysfunction (NICE) Trial	chronic kidney disease	Isoquercetin (NPC179950)	NP level
NCT02289768	Study To Evaluate The Efficacy And Safety Of Actikerall® Solution In Patients With Grade I-II Actinic Keratoses	actinic keratosis	Salicylic Acid (NPC100551)	NP level
NCT01912820	Effect of Quercetin on Green Tea Polyphenol Uptake in Prostate Tissue From Patients With Prostate Cancer Undergoing Surgery	prostate adenocarcinoma	Quercetin (NPC20791)	NP level
NCT04853199	Quercetin In The Treatment Of SARS-COV 2	COVID-19	Quercetin (NPC20791)	NP level
NCT03989271	Biological Effects of Quercetin in COPD	chronic obstructive pulmonary disease	Quercetin (NPC20791)	NP level
NCT00455416	Dietary Intervention in Follicular Lymphoma	follicular lymphoma	Quercetin (NPC20791)	NP level
NCT04648917	GASC1 Inhibitor Caffeic Acid for Squamous Esophageal Cell Cancer (ESCC)	esophageal cancer	Caffeic Acid (NPC294902)	NP level
NCT01362218	Pharmacodynamic Clinical Trial of Cardiovascular Polypill on LDL Cholesterol	Hypercholesterolemia	Salicylic Acid (NPC100551)	NP level
NCT03943459	Sirtuin-1 and Advanced Glycation End-products in Postmenopausal Women With Coronary Disease	coronary artery disease	Quercetin (NPC20791)	NP level
NCT00425074	Pharmacodynamic-pharmacokinetic Trial, of Slow Release ASA, in the Platelet Functionalism.	cardiovascular disease	Salicylic Acid (NPC100551)	NP level
NCT02755545	A Clinical Trial to Evaluate the Efficacy of Two Acne Treatments	acne	Salicylic Acid (NPC100551)	NP level
NCT02226484	Can Quercetin Increase Claudin-4 and Improve Esophageal Barrier Function in GERD?	gastroesophageal reflux disease	Quercetin (NPC20791)	NP level
NCT03832647	Anti-acne Efficacy of a Dermo-cosmetic Product Associated With the Fixed Combination Adapalene 0.1%/ Benzoyl Peroxide 2.5% Treatment Versus This Treatment Associated With a Standard Moisturizer in Male and Female Subjects Presenting With Mild to Moderate Acne	acne	Salicylic Acid (NPC100551)	NP level
NCT01706250	U0289-401: Eight Week, Split-face, Study to Determine and Compare the Efficacy and Tolerability of MAXCLARITY™ II to PROACTIV™	acne	Salicylic Acid (NPC100551)	NP level
NCT05276895	Effect of Natural Senolytic Agents & NLRP3 Inhibitors on Osteoarthritis	osteoarthritis	Quercetin (NPC20791)	NP level
NCT01706263	U0289-402: An Open Label, 8 Week Study to Evaluate the Efficacy and Tolerability of MAXCLARITY II in Subjects With Acne	acne	Salicylic Acid (NPC100551)	NP level
NCT01720147	Quercetin in Children With Fanconi Anemia; a Pilot Study	Fanconi anemia	Quercetin (NPC20791)	NP level
NCT02446795	Isoquercetin as an Adjunct Therapy in Patients With Kidney Cancer Receiving First-line Sunitinib: a Phase I/II Trial	renal cell carcinoma	Isoquercetin (NPC179950)	NP level
NCT02812719	Treatment of Melasma With Glycolic Acid-Salicylic Acid Peel Versus Glycolic Acid Peel	freckles	Salicylic Acid (NPC100551)	NP level
NCT04622865	Masitinib Combined With Isoquercetin and Best Supportive Care in Hospitalized Patients With Moderate and Severe COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT01228656	Effectiveness of Association Mometasone Furoate 0.1% and Salicylic Acid 5% Compared With Mometasone Furoate	psoriasis	Salicylic Acid (NPC100551)	NP level
NCT03503227	The Value of Prednisolone With Aspirin Before Embryo Transfer in Intracytoplasmic Sperm Injection (ICSI) Cycles	infertility	Salicylic Acid (NPC100551)	NP level
NCT01139749	Efficacy and Safety of Low-dose Oral Isotretinoin for Seborrhea	seborrheic dermatitis	Salicylic Acid (NPC100551)	NP level
NCT05062486	A Study to Evaluate the Safety and Efficacy of RQC for AMD	age-related macular degeneration	Quercetin (NPC20791)	NP level
NCT02848131	Senescence in Chronic Kidney Disease	chronic kidney disease	Quercetin (NPC20791)	NP level
NCT04490967	Silymarin Cream Versus Salicylic Acid in Treatment of Acne Vulgaris	acne	Salicylic Acid (NPC100551)	NP level
NCT01453400	Evaluate the Time of Pain Relief of Fast Acting Aspirin Versus Acetaminophen in Subjects Diagnosed With Sore Throat Pain	pharyngitis	Salicylic Acid (NPC100551)	NP level
NCT01229085	Efficacy Study of the Combination Mometasone + Salicylic Acid in Patients With Psoriasis	psoriasis	Salicylic Acid (NPC100551)	NP level
NCT04536090	Study of Isoquercetin (IQC-950AN) Plus Standard of Care Versus Standard of Care Only for the Treatment of COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT00501059	A Study to Assess the Efficacy and Safety of Enteric-Coated Acetylsalicylic Acid in Patients at Moderate Risk of Cardiovascular Disease	cardiovascular disease	Salicylic Acid (NPC100551)	NP level
NCT04733651	Study to Investigate the Clinical Efficacy of Isoquercetin in Patients With COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT03447925	Treatment of Plantar Keratosis With Medicinal Plant in Diabetic Patients	keratosis	Salicylic Acid (NPC100551)	NP level
NCT01705652	Study to Assess the Activity of Nexrutine® in Prostate Cancer Patients	prostate cancer	Rutin (NPC176740)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	MMP1,EGFR,KDR,MET,MMP9,MMP2,SRC,HIF1A,TP53
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	AURKB,PIM1,SRC,AXL,KDM1A,TP53,FLT3,GSK3B,NFKB1
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	DPP4,AKR1B1,MMP9,MMP12,MMP2,FLT3,FUT7,MMP1,NOX4
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	CDK1,AURKB,MMP9,MMP12,ALOX15,ACHE,MMP1,NPSR1,NOX4
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	FLT3,KDR,TP53,MET,MKNK2,MKNK1,EGFR,IGF1R
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	MMP2,MET,KDR,MMP12,EGFR,CA9,MMP9 NCT02446795
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	NFKB1,ALOX5,MMP1,CA2,AKR1B1,MMP9,CA1,ABCG2
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	ALOX5,NFKB1,DPP4,FLT3 MMP12 NCT01228656,NCT01914627,NCT01229085
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	MMP2 NCT00361322,NCT01706250,NCT03832647,NCT02755545,NCT04490967,NCT02524665,NCT01706263
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12,CDK1,AURKB,MMP9,MMP12,XDH,MMP1,CA9
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CDK1,AKR1B1,AURKB,MMP9,CA2,MMP1,CA9,CYP1A2
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CA14,KDM4E,CA1,MMP9,CA2,ACHE,ALOX15,CYP1A1
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA12,CDK1,AURKB,MMP9,MMP12,FUT7,MMP1,CA9
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	TP53,KDM1A,CDK1,SRC,FLT3,DPP4,AURKB
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	IGF1R,MKNK1,CSNK2A1,MET,KDR,EGFR,MKNK2
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	AURKB,MMP9,MMP12,MMP1,NPSR1,CA9,NOX4
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	MMP12,MMP1,NPSR1,CA9,MET,NOX4,CYP1A1
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	DPP4,LMNA,CA4,SRC,CA2,ACHE,SNCA
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA,EGFR,AXL,XDH,MMP2,CYP19A1,HIF1A
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	CA1,AKR1B1,CA4,MET,ACHE,CA2
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	IGF1R,MMP2,EGFR,SRC,TP53,MMP1
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	KDM1A,EGFR,HIF1A,CA9,MKNK1,MKNK2
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	MET,KDR,SRC NCT00425074,NCT00501254,NCT00501059
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	DPP4,NFKB1,AXL,ACHE,CYP19A1,MET
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA12,AURKB,CA2,CYP1A2,MET,CYP1A1
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	SRC,KDR,IGF1R,FLT3,AXL
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	EGFR,KDM1A,AXL,TP53,KDR
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ACHE,KDR,SNCA,FLT3,MET
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	GSK3B,SRC,ACHE,DRD1,SNCA
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA1,CA2,CA12,CA4 NCT01139749
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	AKR1B1,ACHE,IGF1R,ALOX5 NCT03056703
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	SRC,MET,TP53,KDR,FLT3
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	MET,TP53,KDR,MMP9,EGFR
COVID-19 Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D6Y	NCT04733651,NCT04851821,NCT04622865,NCT04853199,NCT04536090
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	MMP9,MMP12,MMP1,CA9,CYP1A1
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	DPP4,MMP2,FUT7,CYP1B1,NOX4
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	EGFR,AXL,TP53,SRC
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA2,CA4,CA14,CA12
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	SRC,FLT3,KDM1A,GSK3B
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	TP53,SRC,FLT3,KDR
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	MMP9 MMP9,MMP12,MMP1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	KDR,AURKB,DPP4,AKR1B1
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	MET,TP53,EGFR,KDR
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	IGF1R,XDH NCT02848131,NCT02552888
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	MMP9,MMP12,NOX4,MMP1
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12,CDK1,MMP9,MMP2
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	IGF1R,FUT7,ABCG2,NOX4
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	MMP9,ACHE,YES1,CYP1A1
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	EGFR,KDR,FLT3
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	ALOX5,MMP12,CA4
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	DPP4,NFKB1 NCT01839344
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KDR,EGFR,MET
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	DPP4,TP53,MET
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	MET,SRC,KDR
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	KDR,EGFR,MET
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	MET,KDR,EGFR
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	EGFR,CDK1,ALOX5
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	ALOX15,NOX4 NCT01912820
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	CA14,CA4,ABCG2
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	DPP4,MMP9,MMP12
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	AXL,MET,FLT3
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	AXL,ACHE,MET
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	MMP9,MET,CA1
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	MMP9,MMP12,NOX4
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	IGF1R,SRC,EGFR,KDR,MMP9,AXL,GSK3B,HIF1A,KDM1A,CDK1,PIM1,TP53,AURKB,CA12,MET,FLT3,CA4,POLB,XDH,CA14,CA9,ALOX5,MKNK2,CSNK2A1,CA2,YES1,NFKB1,CA1,MKNK1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CA14,RECQL,POLB,ACHE,XDH,MMP2,DRD1,MET,LMNA,AURKB,PIM1,CYP1B1,CA7,DPP4,CA2,FUT7,MMP1,NPSR1,SNCA,ALOX15,ALOX5,AXL,NAPRT,CA9,ABCG2,HIF1A
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	RECQL,MMP9,EGFR,XDH,FLT3,DRD1,MET,CA12,CDK1,LMNA,TDP1,AURKB,PIM1,KDR,CA7,DPP4,SRC,MMP12,CSNK2A2,FUT7,MMP1,SNCA,ALOX15,ALOX5,AXL,CA9
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CA14,POLB,HSD17B10,MMP9,XDH,KDM1A,MET,TDP1,TP53,AKR1B1,AURKB,YES1,CA7,DPP4,MMP12,CA2,FUT7,MMP1,NPSR1,ALOX15,CYP19A1,CA9
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	RECQL,HSD17B10,EGFR,ACHE,MMP2,KDM1A,MET,CA12,CDK1,LMNA,TDP1,TP53,AURKB,AKR1B1,KDR,SRC,CSNK2A2,MMP1,AXL,CA9,NOX4
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA14,ALOX12,ACHE,XDH,MMP2,DRD1,MET,HIF1A,CA12,CDK1,CA4,AKR1B1,KDR,DPP4,FUT7,MMP1,NPSR1,SNCA,ALOX5,ABCG2,NOX4
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	IGF1R,ALOX5
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	AURKB NCT01705652
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	HIF1A,DRD1
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	KDR,MET
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CYP19A1,AKR1B1
NA Disease Category: NA Disease ICD-11 Code: NA	NOX4,MET
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	ALOX5,FLT3
Motor neuron disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B60	IGF1R,SRC
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	SRC,FLT3
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	SRC,TP53
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	ALOX5,NFKB1
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1,DRD1
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	SRC,ALOX5
Malignant digestive organ neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C11	SRC,KDR
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	ALOX5,XDH
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	SRC,GSK3B
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	KDR,SRC
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	NFKB1,DPP4
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	FLT3,CDK1
Ischemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B10-8B11	SRC,EGFR
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	NFKB1,SRC
Duodenal ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA63	CA1,CA2
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	SRC,TP53
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	ABCG2,NFKB1
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE,DRD1
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	ALOX5,KDR
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	CA2,XDH
Unspecific body region injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND56	MET,EGFR
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	TP53,SRC
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	MMP9 NCT02313909
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	ALOX5,NFKB1
Esophageal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	TP53 NCT04648917
Hypercholesterolaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80.0	NCT01004705,NCT01362218
Sickle-cell disorder Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A51	NCT04474626,NCT04514510
Tension-type headache Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A81	NCT01012349,NCT01552798
Chronic obstructive pulmonary disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA22	NCT03989271,NCT01708278
Ageing associated decline in intrinsic capacity Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG2A	NCT04946383,NCT05422885
coronary artery disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA8Y-BA8Z	NCT04907253,NCT03943459
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CDK1,CYP1A1
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	AXL,ACHE
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	ABCG2,AURKB
Pre-eclampsia Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA24	CA4,CA1
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	NOX4,MMP1
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	MMP12,FUT7
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	ABCG2,CYP1B1
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA12,CDK1,CA4,AURKB,MMP9,MMP12,MMP1,CA9,CYP19A1,NOX4,CA12,CDK1,SRC,AURKB,MMP9,MMP12,MMP1,CA9,CYP19A1
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	ALOX12,MMP9,XDH,MET,CA12,CSNK2A3,TDP1,TP53,YES1,CYP1A2,MMP12,CA2,FUT7,MMP1,ALOX15,ALOX5,CA9,NOX4
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	ALOX12,MMP9,IGF1R,MMP2,HIF1A,CSNK2A3,CDK1,LMNA,CA4,TP53,AKR1B1,AURKB,SRC,MMP12,MMP1,ALOX5,CA9,NOX4
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA2,CA12,CA1,AXL,SRC,MKNK1,CA4,CYP19A1,CA14,MKNK2,MET,EGFR,IGF1R,CA9,KDR,CDK1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	AURKB,MMP9,ACHE,XDH,CA9,CYP19A1,ALOX5,MET,CA1,AURKB,MMP9,MMP12,FUT7,MMP1,CA9,ALOX5
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA12,CDK1,DPP4,CA4,AURKB,MMP9,MMP12,FUT7,MMP1,CA9,CA7,SNCA,CYP19A1,MET,NOX4
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA12,CDK1,CA4,SRC,AKR1B1,AURKB,CA1,MMP9,MMP12,IGF1R,MMP2,MMP1,CYP19A1,NOX4
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	AXL,IGF1R,EGFR,MET,KDR,MMP12,KDM1A,FLT3,CDK1,ALOX5,MMP1,MMP9,MMP2
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	HSD17B10,MMP9,ACHE,FLT3,DRD1,AKR1B1,NFKB1,CYP1B1,DPP4,MMP12,FUT7,ALOX15,CA9
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	CA14,CA4,MMP9,MMP12,ACHE,XDH,CA2,FUT7,MMP1,SNCA,MET,NOX4
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CDK1,AURKB,MMP9,MMP12,MMP1,NPSR1,DRD1,ALOX15,CYP19A1,MET,NOX4
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	ALOX12,MMP9,XDH,CA12,CDK1,AURKB,CA7,MMP12,MMP1,NPSR1,CA9
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,CDK1,AURKB,MMP9,MMP12,ACHE,XDH,MMP1,NPSR1,CA9,CA7
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CDK1,AURKB,MMP9,MMP12,CA2,ALOX15,XDH,MMP1,NPSR1,CA9,CYP1A1
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA12,DPP4,MMP12,XDH,MMP1,CYP1B1,CA7,ALOX5,MET,NOX4
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA12,CSNK2A3,DPP4,LMNA,CA2,CYP1B1,KDR,CA9,CYP19A1,MET
Synovial sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5A	SRC
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Inborn purine/pyrimidine/nucleotide metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C55	XDH
Inborn metabolism deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5C59	CA14
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	DRD1
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	NFKB1
Lip/oral cavity/pharynx neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6E	TP53
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	CYP19A1
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Abortion Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA00	DRD1
Filariasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F66	ALOX5
Hepatic fibrosis/cirrhosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB93	MMP2
Ischemic heart disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40-BA6Z	MET
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	NFKB1
Adrenomedullary hyperfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A75	HIF1A
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	IGF1R
Intracerebral haemorrhage Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B00	EGFR
Liposarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B59	TP53
Ovarian dysfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80	TP53
Tic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A05	DRD1
Encephalopathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E47	XDH
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4
Human immunodeficiency virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C60-1C62	FLT3
Leiomyosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B58	SRC
Metastatic malignant neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E09	AXL
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	EGFR
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	FLT3
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	CYP19A1
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Inflammatory arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA2Z	FLT3
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	NFKB1
Ulcerative colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD71	MMP9
Ewing sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B52	KDM1A
Metastatic liver/bile duct neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D80	TP53
Multiple structural anomalies syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2F	IGF1R
Testicular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80	EGFR
Autonomic nervous system disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D87	SNCA
Mineral deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B5K	XDH
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	EGFR
Liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB90-DB9Z	MET
Chronic myelomonocytic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A40	FLT3
Extraocular muscle disorder Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C82	IGF1R
Epidermal dysplasias Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK90	SRC
Bone/articular cartilage neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F7B	FLT3
Skin postprocedural disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EL8Y	EGFR
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	DRD1
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	NFKB1
Cocaine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C45	DRD1
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	FLT3
Metastatic digestive system neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D8Y	SRC
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	TP53
Mastocytosis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21	FLT3
Biliary tract cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C17	MET
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	NFKB1
Digestive organ benign neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E92	KDR
Kidney failure Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB60-GB6Z	TP53
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	IGF1R
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	CA2
Urethral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C93	EGFR
Diabetic foot ulcer Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD54	EGFR
Carcinoid syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B10	ALOX5
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	EGFR
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	EGFR
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	AKR1B1
Unspecified viral infection of unspecified site Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D9Z	FLT3
Hypopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6D	EGFR
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	CA2
Metastatic biliary tract neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C14-2C17	EGFR
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	NFKB1
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CA2
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Spinal cord/cranial nerve neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A02	EGFR
Myotonic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71	GSK3B
Phakomatoses/hamartoneoplastic syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2D	FLT3
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	TP53
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	XDH
Fragile X chromosome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD55	GSK3B
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	DPP4
Nasopharyngitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA00	NCT01453400
Gastro-oesophageal reflux disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA22	NCT02226484
Congenital aplastic anaemia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A70.0	NCT01720147
Actinic keratosis Disease Category: X.Extension Codes Disease ICD-11 Code: XH36H6	NCT02289768
Harmful effects of drugs, medicaments or biological substances, not elsewhere classified Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE60	NCT02352987
Freckles Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED61.0	NCT02812719
Lichen planus Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA91	NCT01375101
Thrombophilia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B61	NCT01046942
Malignant neoplasms of other or unspecified parts of mouth Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B66	NCT05456022
Cystic fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA25	NCT01348204
Unspecified malignant neoplasms of unspecified sites Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D4Z	NCT04733534
Immune thrombocytopenic purpura Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64.10	NCT02351622
Macular degeneration Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B75	NCT05062486
Chronic hepatitis C Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E51.1	NCT01438320
Male infertility Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB04	NCT03503227
Osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA00-FA05	NCT05276895
Keratosis pilaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED56	NCT03447925
Deep vein thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD71	NCT01046942
Acute ischaemic heart disease, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA4Z	NCT01294462
Follicular lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A80	NCT00455416
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	PIM1
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	MMP12
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	MMP9
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
Keratoconus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A78.50	CA4
Malignant neoplasms of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	CA1
Dilated cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43.0	ABCG2
Malaria, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F4Z	MMP9

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Citrus Tangerina

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

45 All known Ingredients in Total

18 Ingredients with Acceptable Bioavailablity

29 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Brain cancer

Acute myeloid leukaemia

Leishmaniasis

Malignant neoplasms of oesophagus

Colorectal cancer

Renal cell carcinoma

Rheumatoid arthritis

Psoriasis

Acne vulgaris

Other specified malignant neoplasms of bronchus or lung

Urothelial carcinoma of bladder

Cytomegaloviral disease

Invasive carcinoma of breast

Malignant haematopoietic neoplasm

Liver cancer

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Other specified malignant neoplasms ofcolon

Superficial ovarian endometriosis

Chikungunya virus disease

Glaucoma

Pancreatic cancer

Mature T-cell lymphoma

Cardiovascular disease

West Nile virus infection

Renal cell carcinoma, chromophobe type

Multiple myeloma

Myelodysplastic syndrome

Alzheimer disease

Parkinsonism

Seborrhoeic dermatitis

Pain, unspecified

Ovarian cancer

Stomach cancer

COVID-19

Chronic rhinosinusitis

Carpal tunnel syndrome

Mature B-cell leukaemia

Bacterial infection

Myeloproliferative neoplasm

Peritoneal cancer

Crohn disease

Acute diabete complication

Head and neck cancer

Chronic kidney disease

Inflammatory bowel diseases, unspecified

Osteoarthritis, unspecified

Melanoma of skin

Systemic lupus erythematosus

Chronic pain

Asthma

Type 2 diabetes mellitus

Non-small cell lung cancer

Chronic arterial occlusive disease

Pleomorphic sarcoma

Melanoma

Metastatic lymph node neoplasm

Nasopharyngeal cancer

Adenocarcinoma of prostate

Tetralogy of Fallot

Pneumonia due to Pseudomonasaeruginosa

Human immunodeficiency virus disease without mention of tuberculosis or malaria

Ebola virus disease

Lyme borreliosis

Gliomas of brain