• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Citrus Maxima


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTACCGTAGGTGAACCTATGGTAGGATCATTGTTGGTTCCGAGCCACGAACTGTGTAGGGGAGGAGGCGCGCTCGACATGGTTGGGACTCGTTACCTCCCCGACCCCCGCTCTCGTCGGCGTGTGGACTGGAGGGCCTGTTGACTTGTCGTGCATCTATCTCGTGATTCTCTCTGGATGGATGCCGCGGTGGGCCTCGCACCTCTGTAAGTCATTCACTTGCGGTTCGGGGTATGATTCAAGGGTGTGACGGAGTGTGCCGCTGCACTCCTCGACAGCGCCTGCAGCAGCCGGTGGACTCCTCGAGGAGTCCGTGAGGCACAGCTGCAACCCCCCGTTGCGTCGACGAAGGGAGCAATGTCGTGTAAATGTGCTGTTGGTGGTGCAGACGGGCACACTCGTCAAGCCGCGGGGTAGGACCTCTCGTCGCCGTCCCCTTCCCTCTTTGACGGCATGTGTCCTTCTGATGTTGCGGGGCGGGGACATCTCTCGTCTCACATGCCACCCATGAGGCATCGCCTCTGGACCCCGGTGGCAATTGCAGGATGGGCAGTGTGTCACAAACACTTAACACTGCGGTGCAGTTCACACCAAGGATTGAAAGATAGCCACGCGAGCCGCACGCCGTGTGCGTGCGGGATTGCTTGCGCCAAGAGAACACGACTCTCGACAACAGATATCTCGGCTCTCGCCACGATGAAGAATGTAGCAAAATGTGATACTTAGTGTGAATTGCAGAATCCCATGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTTCAGCTGAGGGCACGTCTGCTTAGGTGTCACACTTCTAAATCGCCCTCCCCCTGCGGCCTTGGGTGGGAGGAGCGGATATGGCCGTCTGTCCCCCAACAGTAGTGCGGTCAGCTTAAACAGGCACGGGGTCCGTCTCCCATGTCACGACGAGTGGTGGCCCAAACGGGTCGGCATTATTTGTGCCGGGTGGGTGCGGCTATGTGCGGAACTTTATCTGGGAGAGGGCAGCTTTGCATGCATGCGGGTCAGCCTGTTTGCCTTCCGCGTTCCTAGGTCAGGCGTGAAT

Click for details-----ITS1

TTACCGTAGGTGAACCTATGGTAGGATCATTGTTGGTTCCGAGCCACGAACTGTGTAGGGGAGGAGGCGCGCTCGACATGGTTGGGACTCGTTACCTCCCCGACCCCCGCTCTCGTCGGCGTGTGGACTGGAGGGCCTGTTGACTTGTCGTGCATCTATCTCGTGATTCTCTCTGGATGGATGCCGCGGTGGGCCTCGCACCTCTGTAAGTCATTCACTTGCGGTTCGGGGTATGATTCAAGGGTGTGACGGAGTGTGCCGCTGCACTCCTCGACAGCGCCTGCAGCAGCCGGTGGACTCCTCGAGGAGTCCGTGAGGCACAGCTGCAACCCCCCGTTGCGTCGACGAAGGGAGCAATGTCGTGTAAATGTGCTGTTGGTGGTGCAGACGGGCACACTCGTCAAGCCGCGGGGTAGGACCTCTCGTCGCCGTCCCCTTCCCTCTTTGACGGCATGTGTCCTTCTGATGTTGCGGGGCGGGGACATCTCTCGTCTCACATGCCACCCATGAGGCATCGCCTCTGGACCCCGGTGGCAATTGCAGGATGGGCAGTGTGTCACAAACACTTAACACTGCGGTGCAGTTCACACCAAGGATTGAAAGATAGCCACGCGAGCCGCACGCCGTGTGCGTGCGGGATTGCTTGCGCCAAGAGAACA

Click for details-----ITS2

CGCCCCCCCACCGGATCTTTCTCCCTTGCGGCCGAGTTCCTGACTTGGCCAAAAAGGAAGAAGGACTCTCCGAGTGAAAGTGGCCGTCCCAACGAGGCACGCTCGTGCTGGTCGGGTCGGCTGAAATAGAGGGAACTCGCTCCGCCGTGGCGGCATTCGCGCCCAGCGATCAGGTGCTCGCGTCGGTCTTCCTCCCCGGAGGAAGAAGGCGCGTTCGTCGGTTTAAGTGCGGGGTTGCAGGTCGCCCCGAGTGCGAGAGATAGAGTTCCAAAGCAGGTCAAGCGGTCTCCAAGTCGTCGGCGTGTCCCCCGACGAGTCCCGGCCCGTCCGGGACTCGCGGCGGCGCGGCGGCGGCTCGGAGTCGCGTCACGC
Taxonomic Information

Plant ID: NPO27288
Plant Latin Name: Citrus Maxima
Taxonomy Genus: Citrus
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 37334
Plant-of-the-World-Online: 30075266-2

Used in Medicines

Country/Region:
Philippines; India

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Ayurveda; Siddha

Geographical Distribution

Jamaica; Bangladesh; Myanmar; Cuba; Gambia; Philippines; Indonesia; India; Cambodia; Trinidad and Tobago; Vietnam; China; Thailand; Dominican Republic; Bolivia; Fiji; Haiti; Ecuador

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

383 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


275 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

166 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99557

Ingredient ID: NPC99480

Ingredient ID: NPC98049

Ingredient ID: NPC97949

Ingredient ID: NPC97285

Ingredient ID: NPC96286

Ingredient ID: NPC95969

Ingredient ID: NPC95675

Ingredient ID: NPC95125

Ingredient ID: NPC95031

Ingredient ID: NPC94167

Ingredient ID: NPC91574

Ingredient ID: NPC89674

Ingredient ID: NPC89088

Ingredient ID: NPC88445

Ingredient ID: NPC86939

Ingredient ID: NPC86564

Ingredient ID: NPC85364

Ingredient ID: NPC85233

Ingredient ID: NPC84793

Ingredient ID: NPC81945

Ingredient ID: NPC81010

Ingredient ID: NPC80170

Ingredient ID: NPC79943

Ingredient ID: NPC79056

Ingredient ID: NPC78551

Ingredient ID: NPC76336

Ingredient ID: NPC76145

Ingredient ID: NPC76026

Ingredient ID: NPC75584

Ingredient ID: NPC75121

Ingredient ID: NPC75110

Ingredient ID: NPC7491

Ingredient ID: NPC74840

Ingredient ID: NPC74539

Ingredient ID: NPC73652

Ingredient ID: NPC73511

Ingredient ID: NPC725

Ingredient ID: NPC72281

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC70206

Ingredient ID: NPC68889

Ingredient ID: NPC67761

Ingredient ID: NPC65003

Ingredient ID: NPC64357

Ingredient ID: NPC64176

Ingredient ID: NPC62290

Ingredient ID: NPC61828

Ingredient ID: NPC61769

Ingredient ID: NPC60288

Ingredient ID: NPC60204

Ingredient ID: NPC58970

Ingredient ID: NPC5893

Ingredient ID: NPC58478

Ingredient ID: NPC57877

Ingredient ID: NPC56741

Ingredient ID: NPC55412

Ingredient ID: NPC55147

Ingredient ID: NPC54341

Ingredient ID: NPC54087

Ingredient ID: NPC53809

Ingredient ID: NPC53720

Ingredient ID: NPC53558

Ingredient ID: NPC53545

Ingredient ID: NPC52230

Ingredient ID: NPC52175

Ingredient ID: NPC51758

Ingredient ID: NPC51700

Ingredient ID: NPC51189

Ingredient ID: NPC50898

Ingredient ID: NPC50786

Ingredient ID: NPC49541

Ingredient ID: NPC4917

Ingredient ID: NPC49151

Ingredient ID: NPC490449

Ingredient ID: NPC489907

Ingredient ID: NPC47946

Ingredient ID: NPC47330

Ingredient ID: NPC45727

Ingredient ID: NPC44931

Ingredient ID: NPC44363

Ingredient ID: NPC44328

Ingredient ID: NPC43587

Ingredient ID: NPC43114

Ingredient ID: NPC41180

Ingredient ID: NPC41004

Ingredient ID: NPC40818

Ingredient ID: NPC39869

Ingredient ID: NPC39633

Ingredient ID: NPC39222

Ingredient ID: NPC39068

Ingredient ID: NPC38751

Ingredient ID: NPC37947

Ingredient ID: NPC37871

Ingredient ID: NPC3649

Ingredient ID: NPC36408

Ingredient ID: NPC34764

Ingredient ID: NPC34440

Ingredient ID: NPC33461

Ingredient ID: NPC32441

Ingredient ID: NPC32259

Ingredient ID: NPC32222

Ingredient ID: NPC312828

Ingredient ID: NPC312132

Ingredient ID: NPC311485

Ingredient ID: NPC310478

Ingredient ID: NPC307011

Ingredient ID: NPC306990

Ingredient ID: NPC305016

Ingredient ID: NPC30430

Ingredient ID: NPC303979

Ingredient ID: NPC302950

Ingredient ID: NPC302556

Ingredient ID: NPC300649

Ingredient ID: NPC300351

Ingredient ID: NPC299856

Ingredient ID: NPC297844

Ingredient ID: NPC297527

Ingredient ID: NPC297422

Ingredient ID: NPC297070

Ingredient ID: NPC296020

Ingredient ID: NPC295608

Ingredient ID: NPC294902

Ingredient ID: NPC294852

Ingredient ID: NPC294548

Ingredient ID: NPC294136

Ingredient ID: NPC291158

Ingredient ID: NPC291124

Ingredient ID: NPC290189

Ingredient ID: NPC290078

Ingredient ID: NPC289758

Ingredient ID: NPC289366

Ingredient ID: NPC289120

Ingredient ID: NPC289014

Ingredient ID: NPC28779

Ingredient ID: NPC287731

Ingredient ID: NPC287660

Ingredient ID: NPC287349

Ingredient ID: NPC286774

Ingredient ID: NPC286626

Ingredient ID: NPC286498

Ingredient ID: NPC285776

Ingredient ID: NPC284295

Ingredient ID: NPC283824

Ingredient ID: NPC279895

Ingredient ID: NPC278460

Ingredient ID: NPC278010

Ingredient ID: NPC277569

Ingredient ID: NPC276009

Ingredient ID: NPC27594

Ingredient ID: NPC273586

Ingredient ID: NPC271921

Ingredient ID: NPC27184

Ingredient ID: NPC271270

Ingredient ID: NPC271003

Ingredient ID: NPC269919

Ingredient ID: NPC26960

Ingredient ID: NPC26906

Ingredient ID: NPC268999

Ingredient ID: NPC266129

Ingredient ID: NPC26600

Ingredient ID: NPC2660

Ingredient ID: NPC265705

Ingredient ID: NPC265644

Ingredient ID: NPC265198

Ingredient ID: NPC264779

Ingredient ID: NPC263428

Ingredient ID: NPC263265

Ingredient ID: NPC262505

Ingredient ID: NPC26229

Ingredient ID: NPC261991

Ingredient ID: NPC261831

Ingredient ID: NPC261080

Ingredient ID: NPC25979

Ingredient ID: NPC259512

Ingredient ID: NPC25810

Ingredient ID: NPC257182

Ingredient ID: NPC25717

Ingredient ID: NPC256989

Ingredient ID: NPC256180

Ingredient ID: NPC255042

Ingredient ID: NPC255041

Ingredient ID: NPC254156

Ingredient ID: NPC252603

Ingredient ID: NPC25255

Ingredient ID: NPC252230

Ingredient ID: NPC252067

Ingredient ID: NPC251666

Ingredient ID: NPC251179

Ingredient ID: NPC250828

Ingredient ID: NPC250769

Ingredient ID: NPC247553

Ingredient ID: NPC246469

Ingredient ID: NPC246358

Ingredient ID: NPC246169

Ingredient ID: NPC246165

Ingredient ID: NPC246033

Ingredient ID: NPC244369

Ingredient ID: NPC243702

Ingredient ID: NPC243509

Ingredient ID: NPC24294

Ingredient ID: NPC242711

Ingredient ID: NPC241032

Ingredient ID: NPC239556

Ingredient ID: NPC239039

Ingredient ID: NPC239037

Ingredient ID: NPC237155

Ingredient ID: NPC236726

Ingredient ID: NPC236602

Ingredient ID: NPC236338

Ingredient ID: NPC233209

Ingredient ID: NPC233169

Ingredient ID: NPC232375

Ingredient ID: NPC232247

Ingredient ID: NPC231738

Ingredient ID: NPC230573

Ingredient ID: NPC227670

Ingredient ID: NPC226869

Ingredient ID: NPC224743

Ingredient ID: NPC22229

Ingredient ID: NPC221733

Ingredient ID: NPC22098

Ingredient ID: NPC220860

Ingredient ID: NPC220031

Ingredient ID: NPC218918

Ingredient ID: NPC217791

Ingredient ID: NPC217226

Ingredient ID: NPC216630

Ingredient ID: NPC215894

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC213903

Ingredient ID: NPC213749

Ingredient ID: NPC213546

Ingredient ID: NPC211960

Ingredient ID: NPC211527

Ingredient ID: NPC210831

Ingredient ID: NPC209970

Ingredient ID: NPC209431

Ingredient ID: NPC209275

Ingredient ID: NPC20791

Ingredient ID: NPC207561

Ingredient ID: NPC20742

Ingredient ID: NPC206589

Ingredient ID: NPC204596

Ingredient ID: NPC203901

Ingredient ID: NPC202865

Ingredient ID: NPC201547

Ingredient ID: NPC200210

Ingredient ID: NPC198743

Ingredient ID: NPC198658

Ingredient ID: NPC19560

Ingredient ID: NPC195246

Ingredient ID: NPC191104

Ingredient ID: NPC190810

Ingredient ID: NPC190771

Ingredient ID: NPC190270

Ingredient ID: NPC190232

Ingredient ID: NPC189955

Ingredient ID: NPC188238

Ingredient ID: NPC187770

Ingredient ID: NPC186394

Ingredient ID: NPC184049

Ingredient ID: NPC183923

Ingredient ID: NPC18351

Ingredient ID: NPC182840

Ingredient ID: NPC182102

Ingredient ID: NPC18205

Ingredient ID: NPC180871

Ingredient ID: NPC180006

Ingredient ID: NPC179831

Ingredient ID: NPC178151

Ingredient ID: NPC177771

Ingredient ID: NPC177731

Ingredient ID: NPC177112

Ingredient ID: NPC176819

Ingredient ID: NPC173760

Ingredient ID: NPC173696

Ingredient ID: NPC173295

Ingredient ID: NPC172833

Ingredient ID: NPC17263

Ingredient ID: NPC169749

Ingredient ID: NPC169468

Ingredient ID: NPC167400

Ingredient ID: NPC167385

Ingredient ID: NPC167106

Ingredient ID: NPC166362

Ingredient ID: NPC166237

Ingredient ID: NPC1656

Ingredient ID: NPC163984

Ingredient ID: NPC163755

Ingredient ID: NPC163751

Ingredient ID: NPC162828

Ingredient ID: NPC162822

Ingredient ID: NPC16157

Ingredient ID: NPC161097

Ingredient ID: NPC15912

Ingredient ID: NPC157805

Ingredient ID: NPC157560

Ingredient ID: NPC157317

Ingredient ID: NPC156654

Ingredient ID: NPC155882

Ingredient ID: NPC155386

Ingredient ID: NPC154466

Ingredient ID: NPC154409

Ingredient ID: NPC154186

Ingredient ID: NPC152538

Ingredient ID: NPC15106

Ingredient ID: NPC150950

Ingredient ID: NPC150329

Ingredient ID: NPC149184

Ingredient ID: NPC149006

Ingredient ID: NPC148478

Ingredient ID: NPC148216

Ingredient ID: NPC148163

Ingredient ID: NPC147162

Ingredient ID: NPC147086

Ingredient ID: NPC14608

Ingredient ID: NPC145988

Ingredient ID: NPC14576

Ingredient ID: NPC145708

Ingredient ID: NPC144707

Ingredient ID: NPC144449

Ingredient ID: NPC143639

Ingredient ID: NPC142860

Ingredient ID: NPC141777

Ingredient ID: NPC141078

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC139545

Ingredient ID: NPC138932

Ingredient ID: NPC138572

Ingredient ID: NPC138347

Ingredient ID: NPC138113

Ingredient ID: NPC13789

Ingredient ID: NPC137816

Ingredient ID: NPC137535

Ingredient ID: NPC135516

Ingredient ID: NPC135353

Ingredient ID: NPC131769

Ingredient ID: NPC131725

Ingredient ID: NPC131482

Ingredient ID: NPC131157

Ingredient ID: NPC130209

Ingredient ID: NPC129680

Ingredient ID: NPC127582

Ingredient ID: NPC126968

Ingredient ID: NPC125191

Ingredient ID: NPC124885

Ingredient ID: NPC124876

Ingredient ID: NPC123526

Ingredient ID: NPC123229

Ingredient ID: NPC12319

Ingredient ID: NPC122487

Ingredient ID: NPC120926

Ingredient ID: NPC120867

Ingredient ID: NPC119381

Ingredient ID: NPC117493

Ingredient ID: NPC116775

Ingredient ID: NPC115674

Ingredient ID: NPC114239

Ingredient ID: NPC114011

Ingredient ID: NPC112701

Ingredient ID: NPC112610

Ingredient ID: NPC109813

Ingredient ID: NPC108494

Ingredient ID: NPC1075

Ingredient ID: NPC106250

Ingredient ID: NPC105509

Ingredient ID: NPC105095

Ingredient ID: NPC105094

Ingredient ID: NPC104450

Ingredient ID: NPC104323

Ingredient ID: NPC103671

Ingredient ID: NPC103209

Ingredient ID: NPC102091

Ingredient ID: NPC10187

Ingredient ID: NPC101285

Ingredient ID: NPC101153

Ingredient ID: NPC100879

Ingredient ID: NPC100809

Ingredient ID: NPC100570