• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Actaea Simplex


Example Image
PLANiTS DNA barcode

Click for details-----ITS

ACGTAGTGACCTGCGGAGGATCATTGTCGATACCTGCTTTGCAGAACGACCCGTGAACACGTTAAAAAACATTATATGGATTGACGAGGAGCGTGAGCTCTTAATCATCCATTGTCGGGTCATGGGATCGACCATGGTTGATCTTATGCTCTCGTACAAACACAAAACCCGGCGCAATTGGCGTCAAGGAAATCTTAGCGGAAACAGAGTGTTGCCCATTTATAGTGGGTGATGCTATGAATCCGATACTTAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTTAGGTTGAGGGCACGTCTGCCTGGGCGTCACACACAGCGTCGTTCCCAACCAATTTTATTAGTTGGGGGATGGAGATTGGCCCCCCGAGTCCTTTTGGGCACGGTTGGCTCAATATTCGTCCTCGGCGGCAAGTGGTCGCGGTCTACGGTGGTTGTAACTCCATCCCCCTAAAACAAAATAAACCGCGTAAGCCTTGGTCTCTACGGACTAAACTAAACCCTTTGGAAGGCGGTCAAGGGTGTCCCCCTCGGCCCCCCAGGCCAGGGGGGGAATATCCCCGCTGATTTAAGACTATCATTAGGGGGAGAGA

Click for details-----ITS1

ACGTAGTGACCTGCGGAAGGATCATTGTCGTACTCTGCTTTGCAGAACGACCCGTGAACACGTTAAAAAACATTATGTGGATTGACGAGGAGCGTGAGCTCTTAATCATCCATTGTCGGGTCATGGGATCGACCATGGTTGATCTTATGCTCTCGTACAAACACAAAACCCGGCGCAATTGGCGTCAAGGAAATCTTAGCGGAAACAGAGTGTTGCCCATTTATAGTGGGTGATGCTACGAATCCGATACTTAAA

Click for details-----ITS2

ACAGCGTCGTTCCCAACCAATTTTATTAGTTGGGGGATGGAGATTGGCCCCCCGAGTCCTTTTGGGCACGGTTGGCTCAATATTCGTCCTCGGCGGCAAGTGGTCGCGGTCTACGGTGGTTGTAACTCCATCCCCCTAAAACAAAATAAACCGCGTAAGCCTTGGTCTCTACGGACTAAACTAAACCCTTTGGAAGGCGGTCAAGGGTGTCCCCCTCGGCCCCCCAGGCCAGGGGGGGAATATCCCCGCTGATTTAAGACTATCATTAGGGGGAGAGA
Taxonomic Information

Plant ID: NPO2727
Plant Latin Name: Actaea Simplex
Taxonomy Genus: Actaea
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 64042
Plant-of-the-World-Online: 708031-1

Used in Medicines

Unknown.

Geographical Distribution

Japan; China; Russia; Mongolia; South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

182 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


130 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

102 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC97260

Ingredient ID: NPC96835

Ingredient ID: NPC96630

Ingredient ID: NPC94885

Ingredient ID: NPC92788

Ingredient ID: NPC90232

Ingredient ID: NPC89422

Ingredient ID: NPC89069

Ingredient ID: NPC85104

Ingredient ID: NPC84030

Ingredient ID: NPC82295

Ingredient ID: NPC78500

Ingredient ID: NPC75158

Ingredient ID: NPC73385

Ingredient ID: NPC70744

Ingredient ID: NPC68889

Ingredient ID: NPC68438

Ingredient ID: NPC67761

Ingredient ID: NPC67180

Ingredient ID: NPC66681

Ingredient ID: NPC66655

Ingredient ID: NPC65871

Ingredient ID: NPC60253

Ingredient ID: NPC59581

Ingredient ID: NPC59570

Ingredient ID: NPC53884

Ingredient ID: NPC53720

Ingredient ID: NPC51758

Ingredient ID: NPC49151

Ingredient ID: NPC49150

Ingredient ID: NPC47768

Ingredient ID: NPC4671

Ingredient ID: NPC46221

Ingredient ID: NPC45270

Ingredient ID: NPC45249

Ingredient ID: NPC43728

Ingredient ID: NPC42471

Ingredient ID: NPC4079

Ingredient ID: NPC38497

Ingredient ID: NPC37644

Ingredient ID: NPC37145

Ingredient ID: NPC37084

Ingredient ID: NPC36108

Ingredient ID: NPC31501

Ingredient ID: NPC312328

Ingredient ID: NPC310478

Ingredient ID: NPC308418

Ingredient ID: NPC308218

Ingredient ID: NPC301696

Ingredient ID: NPC300326

Ingredient ID: NPC29929

Ingredient ID: NPC298504

Ingredient ID: NPC294902

Ingredient ID: NPC294697

Ingredient ID: NPC293391

Ingredient ID: NPC292924

Ingredient ID: NPC292792

Ingredient ID: NPC292078

Ingredient ID: NPC291732

Ingredient ID: NPC291517

Ingredient ID: NPC291255

Ingredient ID: NPC290951

Ingredient ID: NPC287643

Ingredient ID: NPC287550

Ingredient ID: NPC286987

Ingredient ID: NPC286904

Ingredient ID: NPC284731

Ingredient ID: NPC284409

Ingredient ID: NPC283932

Ingredient ID: NPC283655

Ingredient ID: NPC283081

Ingredient ID: NPC278683

Ingredient ID: NPC277907

Ingredient ID: NPC271535

Ingredient ID: NPC269735

Ingredient ID: NPC26906

Ingredient ID: NPC265853

Ingredient ID: NPC264779

Ingredient ID: NPC262505

Ingredient ID: NPC26116

Ingredient ID: NPC261080

Ingredient ID: NPC259381

Ingredient ID: NPC259134

Ingredient ID: NPC258671

Ingredient ID: NPC257124

Ingredient ID: NPC25542

Ingredient ID: NPC255042

Ingredient ID: NPC250013

Ingredient ID: NPC246214

Ingredient ID: NPC239880

Ingredient ID: NPC239147

Ingredient ID: NPC236355

Ingredient ID: NPC235059

Ingredient ID: NPC233533

Ingredient ID: NPC229049

Ingredient ID: NPC228059

Ingredient ID: NPC226250

Ingredient ID: NPC223468

Ingredient ID: NPC221383

Ingredient ID: NPC219969

Ingredient ID: NPC217226

Ingredient ID: NPC216630

Ingredient ID: NPC216127

Ingredient ID: NPC214584

Ingredient ID: NPC212660

Ingredient ID: NPC211363

Ingredient ID: NPC209279

Ingredient ID: NPC208936

Ingredient ID: NPC208075

Ingredient ID: NPC206132

Ingredient ID: NPC204120

Ingredient ID: NPC201844

Ingredient ID: NPC196490

Ingredient ID: NPC194586

Ingredient ID: NPC193252

Ingredient ID: NPC191758

Ingredient ID: NPC190961

Ingredient ID: NPC190771

Ingredient ID: NPC189910

Ingredient ID: NPC189036

Ingredient ID: NPC187061

Ingredient ID: NPC186098

Ingredient ID: NPC186045

Ingredient ID: NPC182840

Ingredient ID: NPC18205

Ingredient ID: NPC180871

Ingredient ID: NPC180684

Ingredient ID: NPC179505

Ingredient ID: NPC179265

Ingredient ID: NPC178382

Ingredient ID: NPC178223

Ingredient ID: NPC176309

Ingredient ID: NPC175342

Ingredient ID: NPC174368

Ingredient ID: NPC171783

Ingredient ID: NPC169222

Ingredient ID: NPC168855

Ingredient ID: NPC166894

Ingredient ID: NPC1656

Ingredient ID: NPC165163

Ingredient ID: NPC164706

Ingredient ID: NPC163556

Ingredient ID: NPC161617

Ingredient ID: NPC161097

Ingredient ID: NPC159606

Ingredient ID: NPC155263

Ingredient ID: NPC154186

Ingredient ID: NPC152899

Ingredient ID: NPC151675

Ingredient ID: NPC150420

Ingredient ID: NPC14917

Ingredient ID: NPC147787

Ingredient ID: NPC147601

Ingredient ID: NPC147343

Ingredient ID: NPC14682

Ingredient ID: NPC14432

Ingredient ID: NPC139546

Ingredient ID: NPC137949

Ingredient ID: NPC137153

Ingredient ID: NPC135353

Ingredient ID: NPC135077

Ingredient ID: NPC133600

Ingredient ID: NPC131063

Ingredient ID: NPC130059

Ingredient ID: NPC12987

Ingredient ID: NPC125144

Ingredient ID: NPC124436

Ingredient ID: NPC119090

Ingredient ID: NPC115301

Ingredient ID: NPC114784

Ingredient ID: NPC114325

Ingredient ID: NPC11232

Ingredient ID: NPC108494

Ingredient ID: NPC108218

Ingredient ID: NPC107907

Ingredient ID: NPC1075

Ingredient ID: NPC105329

Ingredient ID: NPC104514

Ingredient ID: NPC100980

Ingredient ID: NPC100811

Ingredient ID: NPC100551