• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Polygala Tenuifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAAGAGCGACCGTTGGACACGTATATCTTCACGGGGGTGGATGGGTGCATGCGCTGTGCCCTTCCCCCCTTCAAGTCGGGTGGGGACGGATGGGTGGTGCCGGCCTCGTTGGGGTGCGGTTCCCCTCCCCTCCGTGCTCGGCCCGTACTAACAACCAAACTCCGGCGCGAGAAGCGCCAAGGAAATTGTACCGACCGCGCGTGCCCACTATGGCCCCGGAGACGGTGTGCCGATTGGGCCCGCGCTGGACATTTTTGTCGTGTAAACTTAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGCCCTCCCCCGCCTTCGCCTCATCTCTTGGGGCGAGGAGTTGGGGGGGCGGATGTTGGTCTCCCGTGTGCCTTGGCATGCGGCTGGCTGAAAATCACAGGACCACGGTGCACAACGCCGCGTCGCATGGTGGATGAGGTAATCTCTAAGACCGGACGCGTGCGTCGCCGTTGCCTGACAGGACCCACTGCGCTGCGATGCAGTGCCCTCCGACGCGACCCCAGGTCAGGCGGGACC

Click for details-----ITS1

TGTTACGAGTTTTACATTTATCGAAAGAGCGACCGTTGGACACGTATATCTTCACGGGGGTGGATGGGTGCATGCGCTGTGCCCTTCCCCCCTTCAAGTCGGGTGGGGACGGATGGGTGGTGCCGGCCTCGTTGGGGTGCGGTTCCCCTCCCCTCCGTGCTCGGCCCGTACTAACAACCAAACTCCGGCGCGAGAAGCGCCAAGGAAATTGTACCGACCGCGCGTGCCCACTATGGCCCCGGAGACGGTGTGCCGATTGGGCCCGCGCTGGACATTTTTGTCGTGTAAACTTAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO27260
Plant Latin Name: Polygala Tenuifolia
Taxonomy Genus: Polygala
Taxonomy Family: Polygalaceae

Plant External Links:

NCBI TaxonomyDB: 355332
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea; China; South Africa

Traditional Medicine System:
TCM; Kampo


Medicinal Functions:

Cardiotonic; Expectorant; Haemolytic; Kidney; Sedative; Tonic

Geographical Distribution

South Korea; China; South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

171 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


84 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

64 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9985

Ingredient ID: NPC98121

Ingredient ID: NPC98085

Ingredient ID: NPC97316

Ingredient ID: NPC92114

Ingredient ID: NPC90896

Ingredient ID: NPC86533

Ingredient ID: NPC85813

Ingredient ID: NPC8235

Ingredient ID: NPC77272

Ingredient ID: NPC77075

Ingredient ID: NPC73306

Ingredient ID: NPC71853

Ingredient ID: NPC71654

Ingredient ID: NPC67788

Ingredient ID: NPC65873

Ingredient ID: NPC65455

Ingredient ID: NPC65380

Ingredient ID: NPC65116

Ingredient ID: NPC64218

Ingredient ID: NPC63545

Ingredient ID: NPC62885

Ingredient ID: NPC61828

Ingredient ID: NPC61248

Ingredient ID: NPC60616

Ingredient ID: NPC60206

Ingredient ID: NPC58478

Ingredient ID: NPC58077

Ingredient ID: NPC52464

Ingredient ID: NPC5130

Ingredient ID: NPC49808

Ingredient ID: NPC49222

Ingredient ID: NPC48853

Ingredient ID: NPC48840

Ingredient ID: NPC47435

Ingredient ID: NPC474148

Ingredient ID: NPC47276

Ingredient ID: NPC471416

Ingredient ID: NPC46941

Ingredient ID: NPC424

Ingredient ID: NPC40916

Ingredient ID: NPC39633

Ingredient ID: NPC37320

Ingredient ID: NPC34287

Ingredient ID: NPC323169

Ingredient ID: NPC318870

Ingredient ID: NPC311650

Ingredient ID: NPC311172

Ingredient ID: NPC310373

Ingredient ID: NPC308959

Ingredient ID: NPC304208

Ingredient ID: NPC300956

Ingredient ID: NPC300326

Ingredient ID: NPC30025

Ingredient ID: NPC30009

Ingredient ID: NPC2991

Ingredient ID: NPC297417

Ingredient ID: NPC297342

Ingredient ID: NPC294941

Ingredient ID: NPC293578

Ingredient ID: NPC292792

Ingredient ID: NPC292105

Ingredient ID: NPC291828

Ingredient ID: NPC289004

Ingredient ID: NPC28779

Ingredient ID: NPC283839

Ingredient ID: NPC276164

Ingredient ID: NPC276061

Ingredient ID: NPC272941

Ingredient ID: NPC27239

Ingredient ID: NPC271614

Ingredient ID: NPC271501

Ingredient ID: NPC269941

Ingredient ID: NPC26917

Ingredient ID: NPC26727

Ingredient ID: NPC267210

Ingredient ID: NPC266553

Ingredient ID: NPC266249

Ingredient ID: NPC261831

Ingredient ID: NPC258048

Ingredient ID: NPC256989

Ingredient ID: NPC253027

Ingredient ID: NPC252015

Ingredient ID: NPC2518

Ingredient ID: NPC250793

Ingredient ID: NPC247255

Ingredient ID: NPC247025

Ingredient ID: NPC246094

Ingredient ID: NPC243728

Ingredient ID: NPC242260

Ingredient ID: NPC239659

Ingredient ID: NPC237837

Ingredient ID: NPC236579

Ingredient ID: NPC235819

Ingredient ID: NPC231013

Ingredient ID: NPC23002

Ingredient ID: NPC22973

Ingredient ID: NPC229581

Ingredient ID: NPC228383

Ingredient ID: NPC226607

Ingredient ID: NPC226427

Ingredient ID: NPC220748

Ingredient ID: NPC220338

Ingredient ID: NPC216778

Ingredient ID: NPC216630

Ingredient ID: NPC216394

Ingredient ID: NPC21549

Ingredient ID: NPC214153

Ingredient ID: NPC209970

Ingredient ID: NPC208770

Ingredient ID: NPC207797

Ingredient ID: NPC206238

Ingredient ID: NPC204120

Ingredient ID: NPC20377

Ingredient ID: NPC202258

Ingredient ID: NPC20206

Ingredient ID: NPC192123

Ingredient ID: NPC190323

Ingredient ID: NPC189186

Ingredient ID: NPC188167

Ingredient ID: NPC18457

Ingredient ID: NPC1841

Ingredient ID: NPC183036

Ingredient ID: NPC179787

Ingredient ID: NPC179345

Ingredient ID: NPC177479

Ingredient ID: NPC176300

Ingredient ID: NPC171010

Ingredient ID: NPC170219

Ingredient ID: NPC169790

Ingredient ID: NPC167385

Ingredient ID: NPC167252

Ingredient ID: NPC163202

Ingredient ID: NPC162668

Ingredient ID: NPC160125

Ingredient ID: NPC159575

Ingredient ID: NPC157192

Ingredient ID: NPC156856

Ingredient ID: NPC15652

Ingredient ID: NPC155309

Ingredient ID: NPC154932

Ingredient ID: NPC152611

Ingredient ID: NPC152555

Ingredient ID: NPC151110

Ingredient ID: NPC14814

Ingredient ID: NPC147245

Ingredient ID: NPC146443

Ingredient ID: NPC146197

Ingredient ID: NPC143894

Ingredient ID: NPC141549

Ingredient ID: NPC135705

Ingredient ID: NPC134178

Ingredient ID: NPC133061

Ingredient ID: NPC130022

Ingredient ID: NPC128061

Ingredient ID: NPC127415

Ingredient ID: NPC125683

Ingredient ID: NPC125191

Ingredient ID: NPC123965

Ingredient ID: NPC123839

Ingredient ID: NPC122357

Ingredient ID: NPC118940

Ingredient ID: NPC116953

Ingredient ID: NPC116406

Ingredient ID: NPC115323

Ingredient ID: NPC112487

Ingredient ID: NPC111897

Ingredient ID: NPC108970

Ingredient ID: NPC104700

Ingredient ID: NPC101996

Ingredient ID: NPC101970