• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Dysosma Pleiantha


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ACAACGTCGTTCCACCCATCATATCTCTCACCCTATCCGGTTAAGGAATTGATGTATGGAAGTGTACATTGGCCCCCCGTGCCTTACAGGTGTGGTCGGCTCAAAATTTGGCCCTCGGGGATGAGCGTCACGATCAGTGGTGGTTTAAAAACCCCTTTGTCATTGACCGGAATTGTATTAACTCACTCCATATCAGGCTATGTGGACCCTTGTTTGTCGTTAGCACGCCATTCACT
Taxonomic Information

Plant ID: NPO27244
Plant Latin Name: Dysosma Pleiantha
Taxonomy Genus: Dysosma
Taxonomy Family: Berberidaceae

Plant External Links:

NCBI TaxonomyDB: 63349
Plant-of-the-World-Online: 107253-1

Used in Medicines

Unknown.

Geographical Distribution

Taiwan; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

80 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


40 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

27 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95920

Ingredient ID: NPC95381

Ingredient ID: NPC91604

Ingredient ID: NPC88186

Ingredient ID: NPC83733

Ingredient ID: NPC80230

Ingredient ID: NPC79835

Ingredient ID: NPC77184

Ingredient ID: NPC76902

Ingredient ID: NPC75742

Ingredient ID: NPC7479

Ingredient ID: NPC692

Ingredient ID: NPC64381

Ingredient ID: NPC56223

Ingredient ID: NPC50528

Ingredient ID: NPC4309

Ingredient ID: NPC37250

Ingredient ID: NPC33378

Ingredient ID: NPC32833

Ingredient ID: NPC30856

Ingredient ID: NPC307270

Ingredient ID: NPC307113

Ingredient ID: NPC304552

Ingredient ID: NPC301351

Ingredient ID: NPC30009

Ingredient ID: NPC290598

Ingredient ID: NPC284104

Ingredient ID: NPC279624

Ingredient ID: NPC274516

Ingredient ID: NPC273965

Ingredient ID: NPC270674

Ingredient ID: NPC268755

Ingredient ID: NPC267179

Ingredient ID: NPC26306

Ingredient ID: NPC262922

Ingredient ID: NPC25455

Ingredient ID: NPC250781

Ingredient ID: NPC243014

Ingredient ID: NPC242419

Ingredient ID: NPC239890

Ingredient ID: NPC234536

Ingredient ID: NPC232572

Ingredient ID: NPC230301

Ingredient ID: NPC22861

Ingredient ID: NPC227952

Ingredient ID: NPC226168

Ingredient ID: NPC2232

Ingredient ID: NPC217245

Ingredient ID: NPC216515

Ingredient ID: NPC212874

Ingredient ID: NPC209411

Ingredient ID: NPC204025

Ingredient ID: NPC195749

Ingredient ID: NPC194873

Ingredient ID: NPC184608

Ingredient ID: NPC180256

Ingredient ID: NPC1786

Ingredient ID: NPC175795

Ingredient ID: NPC174734

Ingredient ID: NPC16983

Ingredient ID: NPC169493

Ingredient ID: NPC161543

Ingredient ID: NPC160633

Ingredient ID: NPC153375

Ingredient ID: NPC151448

Ingredient ID: NPC147753

Ingredient ID: NPC145901

Ingredient ID: NPC144054

Ingredient ID: NPC139665

Ingredient ID: NPC136633

Ingredient ID: NPC131970

Ingredient ID: NPC129938

Ingredient ID: NPC129683

Ingredient ID: NPC129253

Ingredient ID: NPC126681

Ingredient ID: NPC122819

Ingredient ID: NPC119405

Ingredient ID: NPC119343

Ingredient ID: NPC117911

Ingredient ID: NPC110942