• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Vasconcellea Cundinamarcensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACTAGTTTTATACTCGGGGGCTTCGGGTCCTCCTCGGCGGACCCGTTTCCCTCAGCGCGCGCTCGGGACGGGAGTTGTCTCTCGTCACGGTCCGTGCATTAAACAAACCCCGGCGCGAAAAGCGTCAAGGAACATGAACAAAAGAGCGCTCGCCCGTCGTCCCGTGTCCGGTGTGCGGCGGGTGTTGTGCCGTCTATTGAAATCTACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCTAGGCCATCCGGCTGAGGGCACGTCTGCCTGGGTGTCACGCACAGTCGCCCCCAAAAGTACTCCTTCCCAGCGAAGGTTATTGCTCACCGGGGGCGGATGCTGGCCTCCCGTTCACGCGGCGCATGGCCGTAGCGGTTGGCCCAAATACGAAACCCGGGAAGCGAGCGGCAAGCGATGACGAGTGGTTTAACAAACGCTAAGCTATCTCGGCTGGCTCTGCCCCCCCCCGAAATGACCCTTGAGCATCTCCCCCATCCGGGAAAAGCTCGCACCGCG

Click for details-----ITS1

NA

Click for details-----ITS2

ACAGTCGCCCCCAAAAGTACTCCTTCCCAGCGAAGGTTATTGCTCACCGGGGGCGGATGCTGGCCTCCCGTTCACGCGGCGCATGGCCGTAGCGGTTGGCCCAAATACGAAACCCGGGAAGCGAGCGGCAAGCGATGACGAGTGGTTTAACAAACGCTAAGCTATCTCGGCTGGCTCTGCCCCCCCCCGAAATGACCCTTGAGCATCTCCCCCATCCGGGAAAAGCTCGCACCGCG
Taxonomic Information

Plant ID: NPO27153
Plant Latin Name: Vasconcellea Cundinamarcensis
Taxonomy Genus: Vasconcellea
Taxonomy Family: Caricaceae

Plant External Links:

NCBI TaxonomyDB: 35926
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
India

Traditional Medicine System:
Indian Folk

Geographical Distribution

India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

19 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


7 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC79420

Ingredient ID: NPC71424

Ingredient ID: NPC56726

Ingredient ID: NPC47920

Ingredient ID: NPC3166

Ingredient ID: NPC307292

Ingredient ID: NPC304741

Ingredient ID: NPC300017

Ingredient ID: NPC29883

Ingredient ID: NPC259896

Ingredient ID: NPC251921

Ingredient ID: NPC243227

Ingredient ID: NPC228346

Ingredient ID: NPC219876

Ingredient ID: NPC207983

Ingredient ID: NPC177927

Ingredient ID: NPC168871

Ingredient ID: NPC145388

Ingredient ID: NPC126029