• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Murraya Paniculata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGGGAACTGCGGAAGGATCATTGTCGAAAGCCTTCCCAGCAGAACGACCCGCGAACCAGTTGGAATCACCGGCGGCGGGAGGGGGGACGCGCTCCGCTGCGGGCGCGCCTCCTCGCCCCCCCTTGCTGTCGGGAGTGGGACACGTCCCTATCCCGGCGGCGAAACAACGAACCCCCGGCGCGGACCGCGCCAAGGAAATCCAACGAGAGAGCACGCTCCCGCGGCCCCGGAGACGGTGTGCGGCGGGACGCGGCGCCTTCTTTCACTTGTAATCCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACATAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGCCATGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCACCCCACCCCCCCGGGGGCCCGGCGGTGCGGGCGGATATTGGCCTCCCGTGCGCTCCCCGCTCGCGGTTGGCCCAAATCTGAGTCCTCGGCGACCGAAGCCGCGGCGATCGGTGGTGAATGAAAAGCCTCTCGAGCTCCCGCCGCGTGCCCGGTCTCCGCGAGGGGACTTCGCGACCCTGACGCCCCGCGCAAGCGGCGCTCGCATCGCGACCCCAGGTCAGGCGGGATCACCCCG

Click for details-----ITS1

GGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACCAGTTGGAATCACCGGCGGCGGGAGGGGGGACGCGCTCCGCTGCGGGCGCGCCTCCTCGCCCCCCCTTGCCGTCGGGAGGGGGACACGTCCCTATCCCGGCGGCGAAACAACGAACCCCCGGCGCGGACCGCGCCAAGGAAATCCAACGAGAGAGCACGCTCCCGCGGCCCCGGAGACGGTGTGCGGCGGGACGCGGCGCCTTCTTTCACTTGTAATCCAAAA

Click for details-----ITS2

ATCGTTGCCCCACCCCACCCCCCTGGGGGCCCGGAGGTGCGGGCGTAGATTGGCCTCCCGTGCGCTCCCCGCTCGCGGTTGGCCCAAATCTGAGTCCTCGGCGACCGAAGCCGCGGCGATCGGTGGTGAATGAAAAGCCTCTCGAGCTCCCGCCGCGTGCCCGGTCTCCGCGAGGGGACTTCGCGACCCTGACGCCCGCGCAAGCGGCGCTCGCATCGCGACCCC
Taxonomic Information

Plant ID: NPO2715
Plant Latin Name: Murraya Paniculata
Taxonomy Genus: Murraya
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 43711
Plant-of-the-World-Online: 774441-1

Used in Medicines

Country/Region:
Thailand; Indonesia; China; India

Traditional Medicine System:
TCM; Ayurveda; Siddha

Geographical Distribution

United States; Australia; Bangladesh; Cuba; Philippines; Indonesia; India; Mexico; Cambodia; Mauritius; Trinidad and Tobago; Seychelles; China; Vanuatu; Thailand; Dominican Republic; Venezuela; Haiti

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

264 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


210 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

115 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99480

Ingredient ID: NPC9880

Ingredient ID: NPC9794

Ingredient ID: NPC96286

Ingredient ID: NPC95675

Ingredient ID: NPC95495

Ingredient ID: NPC9430

Ingredient ID: NPC94048

Ingredient ID: NPC91574

Ingredient ID: NPC90954

Ingredient ID: NPC90803

Ingredient ID: NPC90506

Ingredient ID: NPC89410

Ingredient ID: NPC87828

Ingredient ID: NPC86538

Ingredient ID: NPC85233

Ingredient ID: NPC84524

Ingredient ID: NPC79999

Ingredient ID: NPC78551

Ingredient ID: NPC76817

Ingredient ID: NPC76336

Ingredient ID: NPC76145

Ingredient ID: NPC75085

Ingredient ID: NPC7491

Ingredient ID: NPC74119

Ingredient ID: NPC73413

Ingredient ID: NPC7314

Ingredient ID: NPC71703

Ingredient ID: NPC70076

Ingredient ID: NPC69394

Ingredient ID: NPC68889

Ingredient ID: NPC6850

Ingredient ID: NPC67986

Ingredient ID: NPC67840

Ingredient ID: NPC66577

Ingredient ID: NPC61477

Ingredient ID: NPC61225

Ingredient ID: NPC60556

Ingredient ID: NPC60435

Ingredient ID: NPC58478

Ingredient ID: NPC57877

Ingredient ID: NPC56662

Ingredient ID: NPC54503

Ingredient ID: NPC52961

Ingredient ID: NPC52230

Ingredient ID: NPC52175

Ingredient ID: NPC51189

Ingredient ID: NPC45727

Ingredient ID: NPC43114

Ingredient ID: NPC41385

Ingredient ID: NPC41160

Ingredient ID: NPC40818

Ingredient ID: NPC39633

Ingredient ID: NPC39426

Ingredient ID: NPC3937

Ingredient ID: NPC39068

Ingredient ID: NPC38813

Ingredient ID: NPC38099

Ingredient ID: NPC38040

Ingredient ID: NPC36408

Ingredient ID: NPC35519

Ingredient ID: NPC35498

Ingredient ID: NPC35273

Ingredient ID: NPC34770

Ingredient ID: NPC34764

Ingredient ID: NPC326600

Ingredient ID: NPC318056

Ingredient ID: NPC3155

Ingredient ID: NPC31371

Ingredient ID: NPC313163

Ingredient ID: NPC312079

Ingredient ID: NPC309407

Ingredient ID: NPC309182

Ingredient ID: NPC308749

Ingredient ID: NPC307253

Ingredient ID: NPC303644

Ingredient ID: NPC302857

Ingredient ID: NPC302408

Ingredient ID: NPC301771

Ingredient ID: NPC300649

Ingredient ID: NPC30025

Ingredient ID: NPC297643

Ingredient ID: NPC297070

Ingredient ID: NPC296337

Ingredient ID: NPC29536

Ingredient ID: NPC294902

Ingredient ID: NPC294412

Ingredient ID: NPC294409

Ingredient ID: NPC294136

Ingredient ID: NPC290189

Ingredient ID: NPC290078

Ingredient ID: NPC289882

Ingredient ID: NPC289366

Ingredient ID: NPC288759

Ingredient ID: NPC284819

Ingredient ID: NPC284478

Ingredient ID: NPC283790

Ingredient ID: NPC282694

Ingredient ID: NPC282267

Ingredient ID: NPC280965

Ingredient ID: NPC277736

Ingredient ID: NPC277693

Ingredient ID: NPC273687

Ingredient ID: NPC271540

Ingredient ID: NPC271321

Ingredient ID: NPC271087

Ingredient ID: NPC269710

Ingredient ID: NPC269550

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC268718

Ingredient ID: NPC268164

Ingredient ID: NPC267423

Ingredient ID: NPC26628

Ingredient ID: NPC266061

Ingredient ID: NPC265705

Ingredient ID: NPC263334

Ingredient ID: NPC262958

Ingredient ID: NPC261619

Ingredient ID: NPC259512

Ingredient ID: NPC257378

Ingredient ID: NPC257124

Ingredient ID: NPC254156

Ingredient ID: NPC25407

Ingredient ID: NPC252257

Ingredient ID: NPC249815

Ingredient ID: NPC249797

Ingredient ID: NPC2476

Ingredient ID: NPC247266

Ingredient ID: NPC246543

Ingredient ID: NPC246358

Ingredient ID: NPC24615

Ingredient ID: NPC243509

Ingredient ID: NPC24327

Ingredient ID: NPC242701

Ingredient ID: NPC241263

Ingredient ID: NPC240817

Ingredient ID: NPC239039

Ingredient ID: NPC23736

Ingredient ID: NPC236579

Ingredient ID: NPC234933

Ingredient ID: NPC234560

Ingredient ID: NPC232375

Ingredient ID: NPC231738

Ingredient ID: NPC23145

Ingredient ID: NPC230991

Ingredient ID: NPC229916

Ingredient ID: NPC229262

Ingredient ID: NPC229196

Ingredient ID: NPC227378

Ingredient ID: NPC227049

Ingredient ID: NPC226794

Ingredient ID: NPC225710

Ingredient ID: NPC22484

Ingredient ID: NPC223868

Ingredient ID: NPC223848

Ingredient ID: NPC222001

Ingredient ID: NPC220860

Ingredient ID: NPC220111

Ingredient ID: NPC219876

Ingredient ID: NPC218918

Ingredient ID: NPC215932

Ingredient ID: NPC215377

Ingredient ID: NPC215086

Ingredient ID: NPC214909

Ingredient ID: NPC214691

Ingredient ID: NPC214584

Ingredient ID: NPC213867

Ingredient ID: NPC212695

Ingredient ID: NPC209560

Ingredient ID: NPC209275

Ingredient ID: NPC20791

Ingredient ID: NPC205934

Ingredient ID: NPC201547

Ingredient ID: NPC200719

Ingredient ID: NPC200459

Ingredient ID: NPC193289

Ingredient ID: NPC193258

Ingredient ID: NPC193180

Ingredient ID: NPC190924

Ingredient ID: NPC189853

Ingredient ID: NPC187501

Ingredient ID: NPC185538

Ingredient ID: NPC184831

Ingredient ID: NPC184049

Ingredient ID: NPC183864

Ingredient ID: NPC183192

Ingredient ID: NPC182943

Ingredient ID: NPC182840

Ingredient ID: NPC181250

Ingredient ID: NPC180871

Ingredient ID: NPC178638

Ingredient ID: NPC178134

Ingredient ID: NPC177838

Ingredient ID: NPC176962

Ingredient ID: NPC176740

Ingredient ID: NPC176259

Ingredient ID: NPC175987

Ingredient ID: NPC175159

Ingredient ID: NPC173637

Ingredient ID: NPC170170

Ingredient ID: NPC169207

Ingredient ID: NPC167976

Ingredient ID: NPC167385

Ingredient ID: NPC16721

Ingredient ID: NPC166863

Ingredient ID: NPC166303

Ingredient ID: NPC165651

Ingredient ID: NPC165320

Ingredient ID: NPC161749

Ingredient ID: NPC16157

Ingredient ID: NPC15987

Ingredient ID: NPC157781

Ingredient ID: NPC157414

Ingredient ID: NPC15658

Ingredient ID: NPC155999

Ingredient ID: NPC14930

Ingredient ID: NPC148163

Ingredient ID: NPC147920

Ingredient ID: NPC146142

Ingredient ID: NPC143639

Ingredient ID: NPC142691

Ingredient ID: NPC142265

Ingredient ID: NPC141126

Ingredient ID: NPC141080

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC139545

Ingredient ID: NPC139102

Ingredient ID: NPC139085

Ingredient ID: NPC138347

Ingredient ID: NPC13789

Ingredient ID: NPC13473

Ingredient ID: NPC131885

Ingredient ID: NPC131769

Ingredient ID: NPC129489

Ingredient ID: NPC12845

Ingredient ID: NPC126240

Ingredient ID: NPC126029

Ingredient ID: NPC125168

Ingredient ID: NPC125090

Ingredient ID: NPC12269

Ingredient ID: NPC122487

Ingredient ID: NPC120926

Ingredient ID: NPC119381

Ingredient ID: NPC118343

Ingredient ID: NPC116775

Ingredient ID: NPC114239

Ingredient ID: NPC110648

Ingredient ID: NPC11017

Ingredient ID: NPC109944

Ingredient ID: NPC109838

Ingredient ID: NPC109813

Ingredient ID: NPC108494

Ingredient ID: NPC1075

Ingredient ID: NPC107473

Ingredient ID: NPC107327

Ingredient ID: NPC106840

Ingredient ID: NPC106250

Ingredient ID: NPC10455

Ingredient ID: NPC101285

Ingredient ID: NPC100879

Ingredient ID: NPC100809

Ingredient ID: NPC100576