• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Taxus Brevifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TGAACCTGCGGTAGGATCATTGTCGTTTTGAAAACTGAACCGTGCAGGGGAGTGGGCGTGTTCGGCACGTCCGGCGCGTCTCCTCCCCGTCCCCCGCTCTTGCGGGAGTTTGGACTGGAGTTCCGGATGCTTTTCCCTTTGCAATGCCTCGGGGGTCCCCTCCGCTGGCTTTCTCTCGGGTGGGCGTTCCGGTCTTCGCAAGTTGTTCTCCTGCGGTTCGGGTTATTACAAGGGCGAGTGCCAGTGTCGTCTACAGTGTGGCTATGCGAGGTGCCCGTGTTCGGCTGCAGTGGGTGCGCCAGCGACTCTGTTCGTCTGGCAGTCCTGCTCCTTTGCGGTCGAAGGGTCCCAGCAATATCCACCTGCTAGGCGGTTCCTTGCTAACGCCCGTGGCTGCTTTGCAGACCGTTGAACATTTGCCGGTCTGCAAAGCAGCTGCAACCCCCCGAGGTGTCGCCGGGCAGGTTATGCCGTACAGATTATTTCGTGCCTTTGGACGGGTGCACCTGCGTACGTCGCCGGGCGGGACGACCGTCCACTGGTTCCGTTCTCATCTGTTCGGTCTCCGGCCTTTCGACACTCCGGGGCGGGGACACCCTTTCTCCGATTTCCCCCACGGGGCATCGCCTCTGGTTGCAGGGGGGCGTCGAGTGGAGGTGCGTGTCATAACGCTCAACGCATCGGTGCGGATTGCACCAAGGATCTGATAAATAGCTGTGCGGGCTGCGCGCCATGCGCGCGTCGGACTCACGGCGCCAATTAAACA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO27064
Plant Latin Name: Taxus Brevifolia
Taxonomy Genus: Taxus
Taxonomy Family: Taxaceae

Plant External Links:

NCBI TaxonomyDB: 46220
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Canada; China

Traditional Medicine System:
TCM


Medicinal Functions:

Cancer; Diaphoretic; Pectoral; Poultice

Geographical Distribution

Canada; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

96 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


23 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

45 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99094

Ingredient ID: NPC9905

Ingredient ID: NPC98543

Ingredient ID: NPC93398

Ingredient ID: NPC83466

Ingredient ID: NPC81981

Ingredient ID: NPC81010

Ingredient ID: NPC7551

Ingredient ID: NPC75034

Ingredient ID: NPC71230

Ingredient ID: NPC70744

Ingredient ID: NPC67246

Ingredient ID: NPC62382

Ingredient ID: NPC57937

Ingredient ID: NPC53545

Ingredient ID: NPC52127

Ingredient ID: NPC49074

Ingredient ID: NPC473670

Ingredient ID: NPC473558

Ingredient ID: NPC473490

Ingredient ID: NPC471765

Ingredient ID: NPC4131

Ingredient ID: NPC38684

Ingredient ID: NPC38091

Ingredient ID: NPC37250

Ingredient ID: NPC36041

Ingredient ID: NPC33054

Ingredient ID: NPC328084

Ingredient ID: NPC327158

Ingredient ID: NPC326016

Ingredient ID: NPC31829

Ingredient ID: NPC317549

Ingredient ID: NPC316568

Ingredient ID: NPC312800

Ingredient ID: NPC3125

Ingredient ID: NPC312103

Ingredient ID: NPC303808

Ingredient ID: NPC303297

Ingredient ID: NPC300326

Ingredient ID: NPC300017

Ingredient ID: NPC29883

Ingredient ID: NPC29799

Ingredient ID: NPC294902

Ingredient ID: NPC289774

Ingredient ID: NPC287046

Ingredient ID: NPC285720

Ingredient ID: NPC283006

Ingredient ID: NPC281131

Ingredient ID: NPC279121

Ingredient ID: NPC278930

Ingredient ID: NPC278706

Ingredient ID: NPC272026

Ingredient ID: NPC266374

Ingredient ID: NPC263458

Ingredient ID: NPC263212

Ingredient ID: NPC258236

Ingredient ID: NPC245437

Ingredient ID: NPC241930

Ingredient ID: NPC239326

Ingredient ID: NPC229545

Ingredient ID: NPC228072

Ingredient ID: NPC225710

Ingredient ID: NPC219876

Ingredient ID: NPC208553

Ingredient ID: NPC20791

Ingredient ID: NPC197143

Ingredient ID: NPC191193

Ingredient ID: NPC190299

Ingredient ID: NPC189662

Ingredient ID: NPC189142

Ingredient ID: NPC186917

Ingredient ID: NPC18578

Ingredient ID: NPC184289

Ingredient ID: NPC183950

Ingredient ID: NPC181964

Ingredient ID: NPC179950

Ingredient ID: NPC176740

Ingredient ID: NPC174789

Ingredient ID: NPC169210

Ingredient ID: NPC167093

Ingredient ID: NPC15850

Ingredient ID: NPC157460

Ingredient ID: NPC156654

Ingredient ID: NPC153221

Ingredient ID: NPC150307

Ingredient ID: NPC146689

Ingredient ID: NPC137949

Ingredient ID: NPC134685

Ingredient ID: NPC129763

Ingredient ID: NPC117418

Ingredient ID: NPC116391

Ingredient ID: NPC114195

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC104396

Ingredient ID: NPC100551