• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Cynomorium Songaricum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTGAAACTTGCATAGCAGTGCAACTGGGGTAACCTGTAGCGTTAAGCGGGGTGAGATGTGGGCAACCTGTTGGGCCTCACTCTTGCCCTTTCGCCGAAGAAGCTCCAAGTGTCTCGCTTCTAAAACTTTCGAGACATGCGTGTGTTCTCTTGGGCGTGTAACAAATTCCGGCGCGAACAGCGTCAAGGCATACTAGAAGTGGCACGCGCGTGCGCCACGAAACGGTTGCACGCGTGATGCGATTTGGAATCTCAAGGACTCTCGACAACGGATATCTTGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTATTTGAACGCAAGTTGCGCCCAAGGCCTGTGGGTCGAGGGCACATCTGCCTGAGTGTCACTCAATGTGCTGCTGCTTCCTTTCGATTCTCAATTATTTGAGGTGCATTGTAAGAAGCGTTCTGTTGGCCTCCCTTGTCGCTGCAAAGGTTGGCTCAAAAGCTTCATTGTGAGCGGTAAGTCTGCACATTCACTGGTGGGTAGTAAGGCTTGTCCCTTATTGTGGTGTTTGTGTCTGGTCCCTCACTTTTCCCTAGGCCCTGTAAGGTCTTCAATTGGCCCCTTCATTGCGACCTCAGGTCAGGTG

Click for details-----ITS1

TTGAAACTTGCATAGCAGTGCAACTGGGGTAACCTGTAGCGTTAAGCGGGGTGAGATGTGGGCAACCTGTTGGGCCTCACTCTTGCCCTTTCGCCGAAGAAGCTCCAAGTGTCTCGCTTCTAAAACTTTCGAGACATGCGTGTGTTCTCTTGGGCGTGTAACAAATTCCGGCGCGAACAGCGTCAAGGCATACTAGAAGTGGCACGCGCGTGCGCCACGAAACGGTTGCACGCGTGATGCGATTTGGAATCTCAA

Click for details-----ITS2

AATGTGCTGCTGCTTCCTTTCGATTCTCAATTATTTGAGGTGCATTGTAAGAAGCGTTCTGTTGGCCTCCCTTGTCGCTGCAAAGGTTGGCTCAAAAGCTTCATTGTGAGCGGTAAGTCTGCACATTCACTGGTGGGTAGTAAGGCTTGTCCCTTATTGTGGTGTTTGTGTCTGGTCCCTCACTTTTCCCTAGGCCCTGTAAGGTCTTCAATTGGCCCCTTCATTGCGACCTCAGGTCAGGTG
Taxonomic Information

Plant ID: NPO27018
Plant Latin Name: Cynomorium Songaricum
Taxonomy Genus: Cynomorium
Taxonomy Family: Cynomoriaceae

Plant External Links:

NCBI TaxonomyDB: 627609
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

156 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


80 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

70 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96218

Ingredient ID: NPC96146

Ingredient ID: NPC95648

Ingredient ID: NPC94010

Ingredient ID: NPC90566

Ingredient ID: NPC90232

Ingredient ID: NPC88759

Ingredient ID: NPC85944

Ingredient ID: NPC85813

Ingredient ID: NPC83706

Ingredient ID: NPC82477

Ingredient ID: NPC81032

Ingredient ID: NPC77272

Ingredient ID: NPC77126

Ingredient ID: NPC7350

Ingredient ID: NPC7106

Ingredient ID: NPC67920

Ingredient ID: NPC66624

Ingredient ID: NPC64434

Ingredient ID: NPC61477

Ingredient ID: NPC61248

Ingredient ID: NPC59581

Ingredient ID: NPC58478

Ingredient ID: NPC58190

Ingredient ID: NPC57801

Ingredient ID: NPC5326

Ingredient ID: NPC51700

Ingredient ID: NPC49151

Ingredient ID: NPC47596

Ingredient ID: NPC44083

Ingredient ID: NPC43885

Ingredient ID: NPC424

Ingredient ID: NPC39927

Ingredient ID: NPC39633

Ingredient ID: NPC38779

Ingredient ID: NPC36881

Ingredient ID: NPC36061

Ingredient ID: NPC329148

Ingredient ID: NPC3247

Ingredient ID: NPC32279

Ingredient ID: NPC321942

Ingredient ID: NPC32082

Ingredient ID: NPC32047

Ingredient ID: NPC320117

Ingredient ID: NPC309606

Ingredient ID: NPC308749

Ingredient ID: NPC307690

Ingredient ID: NPC305693

Ingredient ID: NPC304309

Ingredient ID: NPC30392

Ingredient ID: NPC301585

Ingredient ID: NPC296031

Ingredient ID: NPC293236

Ingredient ID: NPC290613

Ingredient ID: NPC290563

Ingredient ID: NPC290319

Ingredient ID: NPC29

Ingredient ID: NPC289536

Ingredient ID: NPC288651

Ingredient ID: NPC288537

Ingredient ID: NPC28779

Ingredient ID: NPC287397

Ingredient ID: NPC284039

Ingredient ID: NPC283682

Ingredient ID: NPC282055

Ingredient ID: NPC281814

Ingredient ID: NPC278683

Ingredient ID: NPC278072

Ingredient ID: NPC275358

Ingredient ID: NPC271027

Ingredient ID: NPC270637

Ingredient ID: NPC270215

Ingredient ID: NPC26974

Ingredient ID: NPC268221

Ingredient ID: NPC264711

Ingredient ID: NPC262792

Ingredient ID: NPC262505

Ingredient ID: NPC26229

Ingredient ID: NPC261831

Ingredient ID: NPC261619

Ingredient ID: NPC260995

Ingredient ID: NPC258019

Ingredient ID: NPC256989

Ingredient ID: NPC253416

Ingredient ID: NPC246202

Ingredient ID: NPC245735

Ingredient ID: NPC241144

Ingredient ID: NPC239406

Ingredient ID: NPC238041

Ingredient ID: NPC237837

Ingredient ID: NPC236579

Ingredient ID: NPC236566

Ingredient ID: NPC236202

Ingredient ID: NPC235251

Ingredient ID: NPC230301

Ingredient ID: NPC229

Ingredient ID: NPC228931

Ingredient ID: NPC228776

Ingredient ID: NPC225710

Ingredient ID: NPC223697

Ingredient ID: NPC223455

Ingredient ID: NPC22140

Ingredient ID: NPC219876

Ingredient ID: NPC216630

Ingredient ID: NPC216394

Ingredient ID: NPC216127

Ingredient ID: NPC214610

Ingredient ID: NPC212037

Ingredient ID: NPC21125

Ingredient ID: NPC210979

Ingredient ID: NPC209970

Ingredient ID: NPC208936

Ingredient ID: NPC20791

Ingredient ID: NPC196924

Ingredient ID: NPC196021

Ingredient ID: NPC195019

Ingredient ID: NPC191984

Ingredient ID: NPC19047

Ingredient ID: NPC188042

Ingredient ID: NPC187892

Ingredient ID: NPC187770

Ingredient ID: NPC184593

Ingredient ID: NPC179694

Ingredient ID: NPC176521

Ingredient ID: NPC174213

Ingredient ID: NPC167385

Ingredient ID: NPC165967

Ingredient ID: NPC163755

Ingredient ID: NPC162742

Ingredient ID: NPC161097

Ingredient ID: NPC160512

Ingredient ID: NPC159854

Ingredient ID: NPC157192

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC155187

Ingredient ID: NPC153958

Ingredient ID: NPC153843

Ingredient ID: NPC149203

Ingredient ID: NPC149184

Ingredient ID: NPC140616

Ingredient ID: NPC139029

Ingredient ID: NPC136648

Ingredient ID: NPC13483

Ingredient ID: NPC13059

Ingredient ID: NPC128061

Ingredient ID: NPC127122

Ingredient ID: NPC126029

Ingredient ID: NPC125191

Ingredient ID: NPC123625

Ingredient ID: NPC119107

Ingredient ID: NPC118343

Ingredient ID: NPC114179

Ingredient ID: NPC113989

Ingredient ID: NPC108811

Ingredient ID: NPC105094