• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Gentiana Dahurica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATTCCTGCTAAGCAGACGACACGAGAACATGTTCAACGCACGGGCATTCGGGAAGAGGGAAACCACGGCCCGATGCCCCGAGCATGGCGTCGACAACCGGTCGCTCGTCGTGCAAACAACCAACCCCGGGCACAGAAACGCGCCAAGGAAAACGAAAAAAGGATGGCCTGCCTCCCGTCGTGCCGTACGCGGTGTGCACAGGAGGATCACGGGCGCCTAAAGAAACAAAAACAACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAACTGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGCCACGCATCGCGTCGCCCCCCCAACACCGTGCATGAAACATTGACGGTTGTCGGAGGGGCGGATATTGGCTTCCCGTGCTTCGGTGCGGCTGTCATAAATGCAAGTCCCTTGCGACGGACACAACGACAAGTGGTGGTTGATTGCCTCAACTAAGGTGCTGTCGCGCGTTGCCCCGTCGGATGAGGAGACTTCCTTGACCCCAATGCAAGCGTCGTCAGGACGCCTGCCACGACTGC

Click for details-----ITS1

TCGATTCCTGCTAAGCAGACGACCGGAGAACATGTTTAACGCACGGGCGTTCGGGACGAGGGAAACCACGGCCCGATGCCCCGAGCATGGCGTCGACCACCGGTCGCTCGTCGTGCAAACAACCAACCCCGGGCGCAGAAACGCGCCAAGGAAAACGAAAAAAGGATGGCCTGCCTCCCGTCGTGCCGTACGCGGTGTGCACAGGAGGATCACGGGCGCCTAAAGAAACAAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCCAACACCGTGCATGAAACATTGACGGTTGTCGGAGGGGCGGATATTGGCTTCCCGTGCTTCGGTGCGGCTGTCATAAATGCAAGTCCCTTGCGACGGACACAACGACAAGTGGTGGTTGATTGCCTCAACTAAGGTGCTGTCGCGCGTTGCCCCGTCGGATGAGGAGACTTCCTTGACCCCAATGCAAGCGTCGTCAGGACGCCTGCCACGACTGC
Taxonomic Information

Plant ID: NPO27
Plant Latin Name: Gentiana Dahurica
Taxonomy Genus: Gentiana
Taxonomy Family: Gentianaceae

Plant External Links:

NCBI TaxonomyDB: 225203
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Analgesic; Antiinflammatory; Antipyretic; Antirheumatic; Diuretic; Hypotensive

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

71 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


36 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

31 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95392

Ingredient ID: NPC87419

Ingredient ID: NPC73490

Ingredient ID: NPC69355

Ingredient ID: NPC59581

Ingredient ID: NPC55830

Ingredient ID: NPC55715

Ingredient ID: NPC53545

Ingredient ID: NPC51986

Ingredient ID: NPC51700

Ingredient ID: NPC4574

Ingredient ID: NPC35185

Ingredient ID: NPC34786

Ingredient ID: NPC315566

Ingredient ID: NPC313108

Ingredient ID: NPC309618

Ingredient ID: NPC307699

Ingredient ID: NPC300969

Ingredient ID: NPC295295

Ingredient ID: NPC292009

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289547

Ingredient ID: NPC28779

Ingredient ID: NPC287539

Ingredient ID: NPC285934

Ingredient ID: NPC279959

Ingredient ID: NPC279481

Ingredient ID: NPC279444

Ingredient ID: NPC27636

Ingredient ID: NPC275932

Ingredient ID: NPC2710

Ingredient ID: NPC260268

Ingredient ID: NPC255885

Ingredient ID: NPC255662

Ingredient ID: NPC250109

Ingredient ID: NPC248355

Ingredient ID: NPC243728

Ingredient ID: NPC238205

Ingredient ID: NPC236579

Ingredient ID: NPC230301

Ingredient ID: NPC224651

Ingredient ID: NPC220157

Ingredient ID: NPC217201

Ingredient ID: NPC210108

Ingredient ID: NPC209846

Ingredient ID: NPC20434

Ingredient ID: NPC20117

Ingredient ID: NPC19841

Ingredient ID: NPC184054

Ingredient ID: NPC170448

Ingredient ID: NPC170204

Ingredient ID: NPC164576

Ingredient ID: NPC162656

Ingredient ID: NPC162202

Ingredient ID: NPC161202

Ingredient ID: NPC15924

Ingredient ID: NPC158481

Ingredient ID: NPC153783

Ingredient ID: NPC144419

Ingredient ID: NPC142753

Ingredient ID: NPC142415

Ingredient ID: NPC141273

Ingredient ID: NPC128061

Ingredient ID: NPC125275

Ingredient ID: NPC116368

Ingredient ID: NPC112866

Ingredient ID: NPC107039

Ingredient ID: NPC101806

Ingredient ID: NPC10147

Ingredient ID: NPC101051