• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Micromelum Minutum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTCGCCCTACCTCGCCCTAGCGGTGAGGGCAGACATTGGCCTCCCGTGTGCTCCTTGCTCACGGTTGGCCCAAATCATAGTCTTCAGCGACTGAGGCCGCGATGATCAGTGGTGAAAGCAAAGCCTCTTGAGCTCTCGTCGCGCGTCGGGTCTYCGCGAGGGGGACTCTGCGACCTAGACGCTCCACACGTGAGGCGCTTGCT
Taxonomic Information

Plant ID: NPO26959
Plant Latin Name: Micromelum Minutum
Taxonomy Genus: Micromelum
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 68550
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; China; India

Traditional Medicine System:
Indian Folk; TCM

Geographical Distribution

India; China; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

7 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC70645

Ingredient ID: NPC307063

Ingredient ID: NPC290598

Ingredient ID: NPC27765

Ingredient ID: NPC271232

Ingredient ID: NPC253543

Ingredient ID: NPC230301

Ingredient ID: NPC199204

Ingredient ID: NPC195235

Ingredient ID: NPC192638

Ingredient ID: NPC113733