• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Sanguisorba Officinalis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCTAGCAGAACGACCCGAGAACACGTTTCAACGCTTGGGGGCGGAGGGCCTCGCGGCCCCTCGTCCCCTCATCTCGGGAGGCGAACGTCCCGCGCGTCGCACCTCGGTGCCTCCGCTCGACCGACCCTCCCGGGCGTACTGAACACCGGCGTGAATTGCGCCAAGGAACTTGAATGAAAGAGCGTCTCCCCCGCCGTCTCCGGAGACGGTGCTCGTGCGGGCGGTTTCGTCGTCTTCAATATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACGTCGTTGCCCCCCCCAACCCCTTCGGGGGTCGGACGGGACGGATGATGGCCTCCCGTGTGCTCCGTCACGCGGCTGGCATAAATACCAAGTCCTCGGCGACCAACGCCACGACAATCGGTGGTTGTGAAACCTCGGTGTCCTGTCGTGCGCGCGCGTCGGTCGGGTGCTTTCATGATGCGCGTCGATCCGTCGACGCTTCAACGCGACCCCAGTCAGGCG

Click for details-----ITS1

TCGAAACCTGCCTAGCAGAACGACCCGAGAACACGTTTCAACGCTTGGGGGGGGGGGGCCTCGCGGCCCGTCGTCCCCTCATCTCGGGAGGCGAACGTCCCGCGCGTCGCACCTCGGTGCCTCCGCTCGACCGACCCTCCCGGGCGTACTGAACACCGGCGTGAATTGCGCCAAGGAACTTGAATGAAAGAGCGTCTCCCCCGCCGTCTCCGGAGACGGTGCTCGTGCGGGCGGTTTCGTCGTCTTCAATATGTCTAAA

Click for details-----ITS2

GTCGTTGCCCCCCCCAACCCCTTCGGGGGTCGGACGGGACGGATGATGGCCTCCCGTGTGCTCCGTCACGCGGCTGGCATAAATACCAAGTCCTCGGCGACCAACGCCACGACAATCGGTGGTTGTGAAACCTCGGTGTCCTGTCGTGCGCGCGCGTCGGTCGGGTGCTTTCATGATGCGCGTCGATCCGTCGACGCTTCAACGCGACCCCAGTCAGGCG
Taxonomic Information

Plant ID: NPO26919
Plant Latin Name: Sanguisorba Officinalis
Taxonomy Genus: Sanguisorba
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 137457
Plant-of-the-World-Online: 741402-1

Used in Medicines

Country/Region:
South Korea; Albania; China

Traditional Medicine System:
TCM


Medicinal Functions:

Anodyne; Antidiarrhoeal; Astringent; Contraceptive; Diuretic; Febrifuge; Haemostatic; Tonic; Vulnerary

Geographical Distribution

Canada; Turkey; Italy; Peru; Mongolia; France; Ireland; Norway; Belarus; Iran; Iceland; China; Belgium; Germany; Kazakhstan; Taiwan; Spain; Ukraine; Netherlands; Denmark; Poland; Finland; United States; Sweden; Japan; Switzerland; Russia; Bulgaria; Romania; Albania; South Africa; United Kingdom; Austria; Greece; Hungary; South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

77 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


26 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

32 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99717

Ingredient ID: NPC9590

Ingredient ID: NPC92869

Ingredient ID: NPC88789

Ingredient ID: NPC88445

Ingredient ID: NPC87672

Ingredient ID: NPC84654

Ingredient ID: NPC82505

Ingredient ID: NPC75353

Ingredient ID: NPC72335

Ingredient ID: NPC70068

Ingredient ID: NPC67450

Ingredient ID: NPC61477

Ingredient ID: NPC54243

Ingredient ID: NPC52829

Ingredient ID: NPC52005

Ingredient ID: NPC47521

Ingredient ID: NPC474010

Ingredient ID: NPC39753

Ingredient ID: NPC39620

Ingredient ID: NPC39426

Ingredient ID: NPC37502

Ingredient ID: NPC324067

Ingredient ID: NPC319674

Ingredient ID: NPC318308

Ingredient ID: NPC317111

Ingredient ID: NPC311360

Ingredient ID: NPC31034

Ingredient ID: NPC299844

Ingredient ID: NPC296985

Ingredient ID: NPC293023

Ingredient ID: NPC283806

Ingredient ID: NPC281131

Ingredient ID: NPC275463

Ingredient ID: NPC269315

Ingredient ID: NPC267333

Ingredient ID: NPC264784

Ingredient ID: NPC264711

Ingredient ID: NPC261411

Ingredient ID: NPC252558

Ingredient ID: NPC251791

Ingredient ID: NPC247506

Ingredient ID: NPC246398

Ingredient ID: NPC241454

Ingredient ID: NPC229073

Ingredient ID: NPC22832

Ingredient ID: NPC225710

Ingredient ID: NPC219876

Ingredient ID: NPC219107

Ingredient ID: NPC21408

Ingredient ID: NPC210003

Ingredient ID: NPC198988

Ingredient ID: NPC191347

Ingredient ID: NPC190204

Ingredient ID: NPC187493

Ingredient ID: NPC179950

Ingredient ID: NPC173928

Ingredient ID: NPC164614

Ingredient ID: NPC163297

Ingredient ID: NPC158371

Ingredient ID: NPC15658

Ingredient ID: NPC149540

Ingredient ID: NPC146522

Ingredient ID: NPC145038

Ingredient ID: NPC137264

Ingredient ID: NPC136087

Ingredient ID: NPC135088

Ingredient ID: NPC134730

Ingredient ID: NPC133671

Ingredient ID: NPC131070

Ingredient ID: NPC130395

Ingredient ID: NPC128083

Ingredient ID: NPC124530

Ingredient ID: NPC122809

Ingredient ID: NPC119949

Ingredient ID: NPC112240

Ingredient ID: NPC108218