• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Orobanche Pycnostachya


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGAAGGATCATTGTCGAGTACCTATAAAAGCAGACCGCGAACATGTCAACTATATGGAATTGTGGCGATCACGTCGCATTCCCCTCCCGCATGGCGGGCACCTAGGTGTCCGTTGTGTGGGCTAACGAACCCCGGCGCGGTATGCGCCAAGGAAAACTCATAGAAGCGTCTGCCTCCCCGTTCGCGGTGAGCGTGGGGGGAAAAGATGTCTCTCGAATGTCAAAATGACTCTCGGCAACGGATATCTCGGCTCTCGTATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCAGGCTAAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCCTCCCGTCCCTATGGGGCGTGTTTTTGGTGGGGGCGGATAATGGCCTCCCGTGCACAATAATGTGCGGCTGGCCCAAATGCGAACCCGCGGCGACTCACGTCACGACCAGTGGTGGTTGAATCTTCAACTCTCGTCTGTCGTGTCGGATGGTGTTGCATGTTGGGCTCTATTATAGACCCATAGGCACGAGTTGCTTGTGCTTTCGACTG

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO26857
Plant Latin Name: Orobanche Pycnostachya
Taxonomy Genus: Orobanche
Taxonomy Family: Orobanchaceae

Plant External Links:

NCBI TaxonomyDB: 321418
Plant-of-the-World-Online: 662631-1

Used in Medicines

Unknown.

Geographical Distribution

South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


6 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC86412

Ingredient ID: NPC72722

Ingredient ID: NPC294902

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC278102

Ingredient ID: NPC243728

Ingredient ID: NPC230301

Ingredient ID: NPC220724

Ingredient ID: NPC192065

Ingredient ID: NPC1075