• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ligularia Lamarum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAAACCTGCAAAGCAGAACGACCCGTGAACATGTAACAACAATTGGGTGTCCTTGGTATCGGGCTCTTGTTCGATTAATTGGATGCCTTGTCGATGTKCGTCTTTGGTCAGCCCTTTGGGTCTCCAGGACGTCACATTGGCGCAACAACAAACCCCCGGCACGGCATGTGCCAAGGAAAATTAAACTTAAGAAGGGCATGTACCATGCTTCCYCCCGTTTGTGGGGTTTGCATGGGACGTGGCTTCTTTATAATCACAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO26848
Plant Latin Name: Ligularia Lamarum
Taxonomy Genus: Ligularia
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 308329
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

65 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


42 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

27 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99068

Ingredient ID: NPC85561

Ingredient ID: NPC7973

Ingredient ID: NPC78302

Ingredient ID: NPC7466

Ingredient ID: NPC74580

Ingredient ID: NPC70036

Ingredient ID: NPC67195

Ingredient ID: NPC65435

Ingredient ID: NPC55900

Ingredient ID: NPC49448

Ingredient ID: NPC4481

Ingredient ID: NPC43412

Ingredient ID: NPC312617

Ingredient ID: NPC310934

Ingredient ID: NPC299565

Ingredient ID: NPC29841

Ingredient ID: NPC293539

Ingredient ID: NPC292902

Ingredient ID: NPC288669

Ingredient ID: NPC287979

Ingredient ID: NPC287865

Ingredient ID: NPC286342

Ingredient ID: NPC286170

Ingredient ID: NPC281131

Ingredient ID: NPC266960

Ingredient ID: NPC26596

Ingredient ID: NPC26496

Ingredient ID: NPC262756

Ingredient ID: NPC25495

Ingredient ID: NPC253634

Ingredient ID: NPC238192

Ingredient ID: NPC235215

Ingredient ID: NPC22472

Ingredient ID: NPC22449

Ingredient ID: NPC222750

Ingredient ID: NPC221388

Ingredient ID: NPC219737

Ingredient ID: NPC214138

Ingredient ID: NPC209846

Ingredient ID: NPC208683

Ingredient ID: NPC20791

Ingredient ID: NPC207691

Ingredient ID: NPC204854

Ingredient ID: NPC203050

Ingredient ID: NPC197499

Ingredient ID: NPC19687

Ingredient ID: NPC195046

Ingredient ID: NPC191459

Ingredient ID: NPC190322

Ingredient ID: NPC189958

Ingredient ID: NPC185170

Ingredient ID: NPC176665

Ingredient ID: NPC166778

Ingredient ID: NPC163524

Ingredient ID: NPC142771

Ingredient ID: NPC137915

Ingredient ID: NPC130894

Ingredient ID: NPC117418

Ingredient ID: NPC116775

Ingredient ID: NPC1157

Ingredient ID: NPC115245

Ingredient ID: NPC114132

Ingredient ID: NPC10980

Ingredient ID: NPC105242