• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Terminalia Chebula


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATACCTGCAGAGCAGAACGACCCGCGAACCGTTTTCCAACACCCGGGACACCGGGGGGCGTCCAGCCGCTCGGTAGCCCAAGGCTCCGGACGCCGAGGGTGCAGCCCACCTCCGGCGGATGGAGCTTCAAACAAACCCCGGCGCGCGAAGCGCCAAGGTACTCCAACAACAGGGCACGCGCCCGTAGCCCTGGGTTCCAGTGCGCTCGGGCTGCTGTTCGATGCGATAAAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTCGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGCGCTGCCTCCATACCCTYCACCCCTCGAGCGATGGGAGGATGGTCCGGAAGCGGAAGCTGGCCTCCCGTGACCACGAGCCACGGATGGCCCAAATACGCGCTGGGGAAGCAAAGCGCCACGGCATTCGGTGGTCGATCCGAGCCCCAGAAACAGTGCCCGTGGCGGCCGCATCCGTCCCCAGCCGACGACCCTAAACGTTAACCGACGCGACCTCAGGTCAGGCGGGGCTAC

Click for details-----ITS1

TCGTATCCTGGAAACAGAACGACCCGAGAACGATTAAACATCACTCTCGGCCGGCCGGCATCTTACCGATTCCGCGCCTGCCGATTCCGTGGTTTTGCGTTCGGTCCCCAACAAAGATTTTTATCTTGGTTGGATCGTGCGCATTGCTTCCGGATTTCACCAAACCCCGGCACGAAAAGTGTCAAGGAACATTCAACTAAACAGCCTGCTTCCGCCAACCCGGAGACGGTGTGTTTGTGCGGAAGCTGTGCTGCAATTTAAAGTCTAAAA

Click for details-----ITS2

ATCGCGYTGCCTCCATACCCTCCACCCCTCGAGCGATGGGRRGAYGGTCCGGAAGCGGAAGCTGGCCTCCCGTGACCACGAGCCACGGATGGCCCAAATACGCGCTGGGGAAGCAAAGCGCCACGGCATTCGGTGGTCGATCCGAGCCCCAGAAACAGTGCCCGTGGCGGCCGCATCMGTCCCCAGCCGACGRCCCTAAACGTTAACCRACGCGACCTCAGGTCAGGCGGGGCTAC
Taxonomic Information

Plant ID: NPO26650
Plant Latin Name: Terminalia Chebula
Taxonomy Genus: Terminalia
Taxonomy Family: Combretaceae

Plant External Links:

NCBI TaxonomyDB: 155022
Plant-of-the-World-Online: 171037-1

Used in Medicines

Country/Region:
Thailand; China; India; Pakistan

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy

Geographical Distribution

Pakistan; Bangladesh; Myanmar; Nepal; India; Cambodia; Vietnam; China; Laos; Sri Lanka; Thailand; Taiwan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

205 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


83 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

95 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98907

Ingredient ID: NPC98301

Ingredient ID: NPC96145

Ingredient ID: NPC92676

Ingredient ID: NPC90856

Ingredient ID: NPC90704

Ingredient ID: NPC88976

Ingredient ID: NPC88069

Ingredient ID: NPC85813

Ingredient ID: NPC83706

Ingredient ID: NPC81917

Ingredient ID: NPC80749

Ingredient ID: NPC78500

Ingredient ID: NPC7839

Ingredient ID: NPC78046

Ingredient ID: NPC77249

Ingredient ID: NPC68873

Ingredient ID: NPC66517

Ingredient ID: NPC64370

Ingredient ID: NPC61248

Ingredient ID: NPC60838

Ingredient ID: NPC57544

Ingredient ID: NPC56913

Ingredient ID: NPC5326

Ingredient ID: NPC52955

Ingredient ID: NPC50100

Ingredient ID: NPC47272

Ingredient ID: NPC47063

Ingredient ID: NPC46388

Ingredient ID: NPC4594

Ingredient ID: NPC45802

Ingredient ID: NPC45210

Ingredient ID: NPC42403

Ingredient ID: NPC424

Ingredient ID: NPC41438

Ingredient ID: NPC3857

Ingredient ID: NPC37739

Ingredient ID: NPC36108

Ingredient ID: NPC326183

Ingredient ID: NPC32609

Ingredient ID: NPC32021

Ingredient ID: NPC307783

Ingredient ID: NPC301950

Ingredient ID: NPC301585

Ingredient ID: NPC301583

Ingredient ID: NPC301344

Ingredient ID: NPC301144

Ingredient ID: NPC298865

Ingredient ID: NPC296256

Ingredient ID: NPC294548

Ingredient ID: NPC292663

Ingredient ID: NPC291545

Ingredient ID: NPC290563

Ingredient ID: NPC290319

Ingredient ID: NPC289536

Ingredient ID: NPC28779

Ingredient ID: NPC283956

Ingredient ID: NPC283274

Ingredient ID: NPC282895

Ingredient ID: NPC280501

Ingredient ID: NPC280500

Ingredient ID: NPC280254

Ingredient ID: NPC27965

Ingredient ID: NPC279453

Ingredient ID: NPC279121

Ingredient ID: NPC279026

Ingredient ID: NPC272314

Ingredient ID: NPC271138

Ingredient ID: NPC270946

Ingredient ID: NPC269982

Ingredient ID: NPC269641

Ingredient ID: NPC269095

Ingredient ID: NPC269046

Ingredient ID: NPC268221

Ingredient ID: NPC265988

Ingredient ID: NPC265885

Ingredient ID: NPC264145

Ingredient ID: NPC261831

Ingredient ID: NPC261469

Ingredient ID: NPC259649

Ingredient ID: NPC258000

Ingredient ID: NPC256798

Ingredient ID: NPC249980

Ingredient ID: NPC248976

Ingredient ID: NPC24506

Ingredient ID: NPC242580

Ingredient ID: NPC239406

Ingredient ID: NPC237837

Ingredient ID: NPC237224

Ingredient ID: NPC237202

Ingredient ID: NPC236566

Ingredient ID: NPC236495

Ingredient ID: NPC232514

Ingredient ID: NPC231687

Ingredient ID: NPC226527

Ingredient ID: NPC225710

Ingredient ID: NPC225318

Ingredient ID: NPC224874

Ingredient ID: NPC223697

Ingredient ID: NPC223695

Ingredient ID: NPC220505

Ingredient ID: NPC219969

Ingredient ID: NPC217781

Ingredient ID: NPC217545

Ingredient ID: NPC217226

Ingredient ID: NPC216630

Ingredient ID: NPC216394

Ingredient ID: NPC214153

Ingredient ID: NPC21180

Ingredient ID: NPC209971

Ingredient ID: NPC209970

Ingredient ID: NPC208861

Ingredient ID: NPC208620

Ingredient ID: NPC208527

Ingredient ID: NPC208356

Ingredient ID: NPC208075

Ingredient ID: NPC206997

Ingredient ID: NPC205579

Ingredient ID: NPC204961

Ingredient ID: NPC204458

Ingredient ID: NPC199457

Ingredient ID: NPC199137

Ingredient ID: NPC195615

Ingredient ID: NPC195132

Ingredient ID: NPC194944

Ingredient ID: NPC194857

Ingredient ID: NPC194458

Ingredient ID: NPC191763

Ingredient ID: NPC191556

Ingredient ID: NPC191106

Ingredient ID: NPC190837

Ingredient ID: NPC188693

Ingredient ID: NPC188414

Ingredient ID: NPC187770

Ingredient ID: NPC184993

Ingredient ID: NPC184924

Ingredient ID: NPC184544

Ingredient ID: NPC182226

Ingredient ID: NPC181832

Ingredient ID: NPC181465

Ingredient ID: NPC1813

Ingredient ID: NPC179694

Ingredient ID: NPC178134

Ingredient ID: NPC177213

Ingredient ID: NPC176282

Ingredient ID: NPC173872

Ingredient ID: NPC173582

Ingredient ID: NPC170018

Ingredient ID: NPC167577

Ingredient ID: NPC165967

Ingredient ID: NPC163755

Ingredient ID: NPC163556

Ingredient ID: NPC161434

Ingredient ID: NPC161420

Ingredient ID: NPC16080

Ingredient ID: NPC155185

Ingredient ID: NPC154780

Ingredient ID: NPC154477

Ingredient ID: NPC153814

Ingredient ID: NPC153524

Ingredient ID: NPC152826

Ingredient ID: NPC151719

Ingredient ID: NPC151547

Ingredient ID: NPC150147

Ingredient ID: NPC149716

Ingredient ID: NPC149300

Ingredient ID: NPC146197

Ingredient ID: NPC142291

Ingredient ID: NPC14030

Ingredient ID: NPC138334

Ingredient ID: NPC137917

Ingredient ID: NPC137153

Ingredient ID: NPC136996

Ingredient ID: NPC136176

Ingredient ID: NPC135962

Ingredient ID: NPC1321

Ingredient ID: NPC130923

Ingredient ID: NPC13059

Ingredient ID: NPC130348

Ingredient ID: NPC12987

Ingredient ID: NPC129560

Ingredient ID: NPC129533

Ingredient ID: NPC128925

Ingredient ID: NPC128825

Ingredient ID: NPC128061

Ingredient ID: NPC126759

Ingredient ID: NPC125410

Ingredient ID: NPC125144

Ingredient ID: NPC124543

Ingredient ID: NPC123965

Ingredient ID: NPC123259

Ingredient ID: NPC12231

Ingredient ID: NPC119107

Ingredient ID: NPC119094

Ingredient ID: NPC118244

Ingredient ID: NPC116794

Ingredient ID: NPC113621

Ingredient ID: NPC111255

Ingredient ID: NPC109625

Ingredient ID: NPC106386

Ingredient ID: NPC102907

Ingredient ID: NPC102495

Ingredient ID: NPC102449

Ingredient ID: NPC101888

Ingredient ID: NPC100980