CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Ardisia Crenata

Example Image

PLANiTS DNA barcode

Click for details-----ITS

CATTGTCAAACCTGCATAGCAGAACGACCCGTGAACTTGTCTTTACATAGGGGACACATCGGATGGGTCATTGACCCTCCGGTGTCATCCCCTGCTAGTGGGTGAGCTCGTTCTCCGTCTCGGTTGCGAGTTCACTTTCCTAGTCGAACAACGAACCCCGGCGCAAACCGCGCCAAGGAAATCAAACAAAGAGATCGCACCCCTTATTCCTGTGCGCGGGTTGTGAGGGGTGATAGAATCTTGCATATAACAAAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCCCACAATGCGTCGCTCCCCCACTCACCCTCGGGTGTCGTGTGAGGTGCGGATATTGGCTCCCCGTGTGCTATCGTGCGCGGTCAGCCTAAAAGTGAATCCCGACGATCGGTGTCGCGGCAAGTGGTGGTTTCCAAACCGTTGCATGTTGTCGTGCGCGCTTCGATCGCCCTCGGTGACTCCTTGACCCTGAGCTCCATTAGAATGGCGCCACGATCGAGACCCC

Click for details-----ITS1

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO26639
Plant Latin Name: Ardisia Crenata
Taxonomy Genus: Ardisia
Taxonomy Family: Primulaceae

Plant External Links:

NCBI TaxonomyDB: 13345
Plant-of-the-World-Online: 586890-1

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Medicinal Functions:

Anodyne; Depurative; Febrifuge

Geographical Distribution

United States; Australia; Myanmar; South Africa; Philippines; India; Cambodia; Mauritius; Seychelles; China; Vietnam; Laos; Japan; Taiwan; Thailand

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

21 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

1 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC93970

Ingredient ID: NPC78034

Ingredient ID: NPC6965

Ingredient ID: NPC53109

Ingredient ID: NPC47960

Ingredient ID: NPC40716

Ingredient ID: NPC35712

Ingredient ID: NPC304375

Ingredient ID: NPC283394

Ingredient ID: NPC268366

Ingredient ID: NPC257566

Ingredient ID: NPC217819

Ingredient ID: NPC209654

Ingredient ID: NPC166820

Ingredient ID: NPC157571

Ingredient ID: NPC143168

Ingredient ID: NPC138219

Ingredient ID: NPC126753

Ingredient ID: NPC119628

Ingredient ID: NPC116850

Ingredient ID: NPC110899

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Isomerase	PTGES	Prostaglandin E synthase	O14684	CHEMBL5658
Therapeutic Target	Oxidoreductase	ALOX5	Arachidonate 5-lipoxygenase	P09917	CHEMBL215
Therapeutic Target	Protein Kinase	MAPK1	MAP kinase ERK2	P28482	CHEMBL4040
Therapeutic Target	Unclassified protein	MPEG1	Macrophage-expressed gene 1 protein	Q2M385	CHEMBL3414409

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	PTGES,GPR84,MPEG1,ALOX5,IL6
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	MAPK1,GPR84,MPEG1,ALOX5,IL6
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	GPR84,MPEG1,PTGES,ALOX5
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	GPR84,ALOX5,GPR84,ALOX5
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	GPR84,MPEG1,PTGES,ALOX5
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	ALOX5,MAPK1,XIAP
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	IL6 GPR84,IL6
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	GPR84,PTGES,ALOX5
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	GPR84,MPEG1,IL6
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	GPR84,MPEG1,IL6
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	XIAP,ALOX5
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	IL6,XIAP
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	ALOX5,IL6
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	GPR84,ALOX5
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	IL6,XIAP
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	GPR84,PTGES
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	GPR84,IL6
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	MPEG1,PTGES
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	IL6,PTGES
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	GPR84,MPEG1
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	IL6,PTGES
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	GPR84,IL6
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	GPR84,PTGES
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	GPR84,PTGES
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	GPR84,PTGES
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	MPEG1,PTGES
Malaria, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F4Z	GPR84,PTGES
Filariasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F66	ALOX5
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	MAPK1
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	ALOX5
Anemia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A00-3A9Z	IL6
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	XIAP
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	XIAP
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	ALOX5
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ALOX5
Psoriatic arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA21	IL6
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	MAPK1
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	ALOX5
Cutaneous lupus erythematosus Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EB50-EB5Z	IL6
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	ALOX5
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	GPR84
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	XIAP
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	XIAP
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	XIAP
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	ALOX5
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	ALOX5
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	IL6
Arteries/arterioles disorder Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD52	MAPK1
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	PTGES
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	IL6
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	XIAP
Vasculitis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A44	IL6
Carcinoid syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B10	ALOX5
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	XIAP
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	ALOX5
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	ALOX5
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	ALOX5
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	PTGES
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	IL6
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	GPR84
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	GPR84
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	PTGES
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	GPR84
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	PTGES
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	PTGES
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	GPR84
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	GPR84
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	ALOX5
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	GPR84
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	XIAP
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	GPR84
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	IL6
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	PTGES

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Ardisia Crenata

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

21 All known Ingredients in Total

1 Ingredients with Acceptable Bioavailablity

12 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

Germ cell tumour of testis

Serous cystadenoma,borderline malignancy of ovary

Other specified malignant neoplasms of kidney, except renal pelvis

Mesothelioma of pleura

Solid tumour/cancer

Crohn disease

Malignant neoplasms of biliary tract, distal bile duct

Human immunodeficiency virus disease without mention of tuberculosis or malaria

Glioblastoma of brain

Nasopharyngeal cancer

Malignant haematopoietic neoplasm

Rheumatoid arthritis

Idiopathic interstitial pneumonitis

Multiple myeloma

Carcinosarcoma of uterus

Inflammatory bowel diseases, unspecified

Osteoarthritis, unspecified

Hepatoblastoma

Leishmaniasis

Diffuse large B-cell lymphomas

West Nile virus infection

Malignant neoplasms of oesophagus

Adenocarcinoma of bronchus or lung

Chikungunya virus disease

Malignant neoplasms of thymus

Malaria, unspecified

Filariasis

Pancreatic cancer

Influenza

Anemia

Acute myeloid leukaemia

Obesity

Lung cancer

Pain, unspecified

Psoriatic arthritis

Melanoma

Asthma

Cutaneous lupus erythematosus

Thrombocytopenia

Type 2 diabetes mellitus

Ovarian cancer

Metastatic lymph node neoplasm

Breast cancer

Postoperative inflammation

Fungal infection

Lupus erythematosus

Arteries/arterioles disorder

Alzheimer disease

Depression

Mature T-cell lymphoma

Vasculitis

Carcinoid syndrome

Myeloproliferative neoplasm

Pituitary gland disorder

Psoriasis

Atopic eczema

Pheochromocytoma

Zika virus disease

Multiple sclerosis

Adenocarcinoma of stomach