• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Taraxacum Officinale


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAGGCAGAACGACCTGTGAACACGTAAATACAACTGTGATGGGGAGATGGATCTTGGTTCTGATCCTCAACACCTCCTAGCGTGCCTGCATGCTTTCTCTTTTGGGCTATCATGCATGTATTGTTGGAATTTAACAAAACCCCGGCACGGCATGTGCCAAGGAAAACAATAAACGAGAAGGACTCGACCTGTTATGCCCCGTTTTGTGGTGTGCATTCTGAGCGTGTCCTCCTTTGAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGTTTAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCATCATACTTCCCTTAAGGGTAGTCGTGGTGATTGGGAGCGGAGATTGGCCTCCCGTGCTTGTTGTGCGGTTGGTCAAAATAGGAGTCCCATTCGGTGGACACACGGCTAGTGGTGGTTGTAAAGACCCTTTTCTTCTGCTGTGTGTTGTGAGCTGCTAGGGAAACCCTCAAAAAAGAACCCAATGTATCGTTCTAGGACGATGCTTCGA

Click for details-----ITS1

GTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAGGCAGAACGACCTGTGAACACGTAAATACAACTGTGATGGGGAGATGGATCTTGGTTCTGATCCTCAACACCTCCTAGCGTGCCTGCATGCTTTCTCTTTTGGGCTATCATGCATGTATTGTTGGAATTTAACAAAACCCCGGCACGGCATGTGCCAAGGAAAACAATAAACGAGAAGGACTCGACCTGTTATGCCCCGTTTTGTGGTGTGCATTCTGAGCGTGTCCTCCTTTGAATCACAAA

Click for details-----ITS2

ATCGCGTCGCCCCTTATCATAATTCCCTTAAGGGTAGTCGTGGTGATTGGGCGCGGAGATTGGCTTCCCGTGCTTGTTGTGCGGTTGGTCAAAATAGGAGTCCCCTTCGGTGGACACACGGCTAGTGGTGGTTGTAAAGACCCTTTTCTTCTGCTGTGTGTTGTGAGCTGCTAGGGAAACCCTCAAAAAAGAACCCAATGTATCGTTCTAGGACGATGCTTCGACC
Taxonomic Information

Plant ID: NPO26622
Plant Latin Name: Taraxacum Officinale
Taxonomy Genus: Taraxacum
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 50225
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Pakistan; Finland; Albania; Italy; Lebanon; Tanzania; Indonesia; India; Sweden; Rwanda; China; Chile; Kenya; Argentina; Russia; Spain

Traditional Medicine System:
Indian Folk; TCM; Homeopathy; Ayurveda


Medicinal Functions:

Aperient; Cholagogue; Depurative; Diuretic; Hepatic; Hypoglycaemic; Laxative; Miscellany; Stomachic; Tonic; Warts

Geographical Distribution

Pakistan; Albania; Italy; Indonesia; Lebanon; Tanzania; Finland; India; Sweden; Rwanda; China; Chile; Kenya; Argentina; Russia; Spain

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

213 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


101 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

120 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98543

Ingredient ID: NPC96403

Ingredient ID: NPC96218

Ingredient ID: NPC95381

Ingredient ID: NPC94167

Ingredient ID: NPC92774

Ingredient ID: NPC90856

Ingredient ID: NPC88789

Ingredient ID: NPC85813

Ingredient ID: NPC85550

Ingredient ID: NPC836

Ingredient ID: NPC81775

Ingredient ID: NPC81010

Ingredient ID: NPC79056

Ingredient ID: NPC78046

Ingredient ID: NPC7208

Ingredient ID: NPC71296

Ingredient ID: NPC70756

Ingredient ID: NPC70744

Ingredient ID: NPC70388

Ingredient ID: NPC69445

Ingredient ID: NPC66700

Ingredient ID: NPC56023

Ingredient ID: NPC55412

Ingredient ID: NPC5326

Ingredient ID: NPC52005

Ingredient ID: NPC50898

Ingredient ID: NPC490334

Ingredient ID: NPC489907

Ingredient ID: NPC48892

Ingredient ID: NPC47063

Ingredient ID: NPC46388

Ingredient ID: NPC44328

Ingredient ID: NPC41326

Ingredient ID: NPC39793

Ingredient ID: NPC38751

Ingredient ID: NPC3780

Ingredient ID: NPC37739

Ingredient ID: NPC3357

Ingredient ID: NPC32977

Ingredient ID: NPC328788

Ingredient ID: NPC328447

Ingredient ID: NPC328059

Ingredient ID: NPC326618

Ingredient ID: NPC32626

Ingredient ID: NPC32589

Ingredient ID: NPC323787

Ingredient ID: NPC323349

Ingredient ID: NPC321491

Ingredient ID: NPC320240

Ingredient ID: NPC32021

Ingredient ID: NPC318538

Ingredient ID: NPC318138

Ingredient ID: NPC306990

Ingredient ID: NPC30374

Ingredient ID: NPC302950

Ingredient ID: NPC302857

Ingredient ID: NPC302003

Ingredient ID: NPC299856

Ingredient ID: NPC29884

Ingredient ID: NPC29883

Ingredient ID: NPC295832

Ingredient ID: NPC295154

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC290613

Ingredient ID: NPC290598

Ingredient ID: NPC290319

Ingredient ID: NPC29

Ingredient ID: NPC289774

Ingredient ID: NPC289758

Ingredient ID: NPC288714

Ingredient ID: NPC285364

Ingredient ID: NPC281457

Ingredient ID: NPC281131

Ingredient ID: NPC279865

Ingredient ID: NPC279121

Ingredient ID: NPC278102

Ingredient ID: NPC278068

Ingredient ID: NPC27359

Ingredient ID: NPC272614

Ingredient ID: NPC271138

Ingredient ID: NPC270077

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC26960

Ingredient ID: NPC269095

Ingredient ID: NPC268221

Ingredient ID: NPC2660

Ingredient ID: NPC261831

Ingredient ID: NPC258000

Ingredient ID: NPC256798

Ingredient ID: NPC252558

Ingredient ID: NPC251407

Ingredient ID: NPC248976

Ingredient ID: NPC245947

Ingredient ID: NPC245561

Ingredient ID: NPC245346

Ingredient ID: NPC242580

Ingredient ID: NPC24146

Ingredient ID: NPC237506

Ingredient ID: NPC236340

Ingredient ID: NPC234133

Ingredient ID: NPC230301

Ingredient ID: NPC225710

Ingredient ID: NPC224389

Ingredient ID: NPC223697

Ingredient ID: NPC222696

Ingredient ID: NPC220089

Ingredient ID: NPC217052

Ingredient ID: NPC216630

Ingredient ID: NPC214134

Ingredient ID: NPC213935

Ingredient ID: NPC21290

Ingredient ID: NPC210040

Ingredient ID: NPC209970

Ingredient ID: NPC20791

Ingredient ID: NPC20742

Ingredient ID: NPC207339

Ingredient ID: NPC206095

Ingredient ID: NPC205003

Ingredient ID: NPC204458

Ingredient ID: NPC203719

Ingredient ID: NPC20286

Ingredient ID: NPC202642

Ingredient ID: NPC200502

Ingredient ID: NPC198398

Ingredient ID: NPC197376

Ingredient ID: NPC196924

Ingredient ID: NPC196776

Ingredient ID: NPC195132

Ingredient ID: NPC194562

Ingredient ID: NPC192638

Ingredient ID: NPC192402

Ingredient ID: NPC192400

Ingredient ID: NPC191763

Ingredient ID: NPC191306

Ingredient ID: NPC190837

Ingredient ID: NPC19074

Ingredient ID: NPC19047

Ingredient ID: NPC19045

Ingredient ID: NPC189436

Ingredient ID: NPC189142

Ingredient ID: NPC187770

Ingredient ID: NPC183993

Ingredient ID: NPC183815

Ingredient ID: NPC182102

Ingredient ID: NPC181832

Ingredient ID: NPC181455

Ingredient ID: NPC181153

Ingredient ID: NPC179950

Ingredient ID: NPC17810

Ingredient ID: NPC1777

Ingredient ID: NPC176740

Ingredient ID: NPC176300

Ingredient ID: NPC175378

Ingredient ID: NPC171736

Ingredient ID: NPC169749

Ingredient ID: NPC1682

Ingredient ID: NPC167976

Ingredient ID: NPC167400

Ingredient ID: NPC16728

Ingredient ID: NPC165967

Ingredient ID: NPC162797

Ingredient ID: NPC161434

Ingredient ID: NPC158040

Ingredient ID: NPC157288

Ingredient ID: NPC156655

Ingredient ID: NPC156654

Ingredient ID: NPC156353

Ingredient ID: NPC154792

Ingredient ID: NPC153958

Ingredient ID: NPC153524

Ingredient ID: NPC15336

Ingredient ID: NPC150950

Ingredient ID: NPC1507

Ingredient ID: NPC147983

Ingredient ID: NPC146197

Ingredient ID: NPC145038

Ingredient ID: NPC143586

Ingredient ID: NPC142753

Ingredient ID: NPC142703

Ingredient ID: NPC138334

Ingredient ID: NPC137949

Ingredient ID: NPC137917

Ingredient ID: NPC136014

Ingredient ID: NPC135962

Ingredient ID: NPC135088

Ingredient ID: NPC133852

Ingredient ID: NPC132446

Ingredient ID: NPC132307

Ingredient ID: NPC131174

Ingredient ID: NPC130683

Ingredient ID: NPC130444

Ingredient ID: NPC129206

Ingredient ID: NPC128925

Ingredient ID: NPC126925

Ingredient ID: NPC126759

Ingredient ID: NPC117493

Ingredient ID: NPC116709

Ingredient ID: NPC115979

Ingredient ID: NPC11433

Ingredient ID: NPC113733

Ingredient ID: NPC113212

Ingredient ID: NPC113101

Ingredient ID: NPC112454

Ingredient ID: NPC111897

Ingredient ID: NPC110899

Ingredient ID: NPC110377

Ingredient ID: NPC109736

Ingredient ID: NPC10781

Ingredient ID: NPC1075

Ingredient ID: NPC104216