CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Ilex Paraguariensis

Example Image

PLANiTS DNA barcode

Click for details-----ITS

GTAGGTGAACTGCGGAAGGTCATTGTCGAGAGCCCTAAAAGTCCATGCGACTGTGAAAAACCGTGCGAGGATGGGTGCGAAACTGATGCCCTGCTCTGTCTCCAACCAGTGTGGGCGCTTTCGTGGGGAGCGGTCCATGTGGCGGTGGGAAAACCAGGATGTGGGCGAAGTTACGCGCCAAGGGACGAGTGAATGTTGTTTTTGCGACGTCGCCGGCCGTGGAACCAGAATGGGTTGGCGAGGCGTGACACGTGTAATCGATCAAAGGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATATGTGTTGTGAATTGCAGAATCCCGTGAACCATCCAGTCTTTGAACGCAAGTCGCGCCCGAGGATGCAAGCCGAGGGCACGCCTGCATGGGTGTGATGCATTGTATGTTTGCTCCTTGCAGATGTTCGAACCCGCCTTTAGGGTTCCTCGGGATTTGTTTGGAGGCGAGCAGTGGCTCCCCGTGCTGCAGCATGGTGGGTTGAAGCGCGGGTCGATGATCGGCTGGTGACGTTATTGGAGGTGGACGACGCATGCTGTCGCGCAAGCGGCCATAAGGACATTCCGTTGCAGCCTTCCGCTTGTATGACCCTTGCAAAACCAACTCCACGCACCTTTTTGTGGATCGTGACCCCATGTCAGGCGAGCTACCCCC

Click for details-----ITS1

TTGTCGATGCCTGCAACGTAGACCCGGCGAACTTGTTAAAATACGCTGGGGGGGTTTGGGAAGGGGTGCGCGAGCCCCCCCGAACACACTCCCCCGCCCTCGGGACTGGGCTTGTGTTCCCCTCCCTAGGGGGGGGACTCGGTCGAGCTCCCGACAAACGAACCCCGGCGCTGTCTGTGCCAAGGAACCATAACCGAAGAGCTGGTCTCCCGATGTCCCGTTCGCGGTGCGCACGGGAGGCATTTGCATCTTTTTGAAATCTAAAA

Click for details-----ITS2

ATTGTATGTTTGCTCCTTGCAGATGTTCGAACCCGCCTTTAGGGTTCCTCGGGATTTGTTTGGAGGCGAGCAGTGGCTCCCCGTGCTGCAGCATGGTGGGTTGAAGCGCGGGTCGATGATCGGCTGGTGACGTTATTGGAGGTGGACGACGCATGCTGTCGCGCAAGCGGCCATAAGGACATTCCGTTGCAGCCTTCCGCTTGTATGACCCTTGCAAAACCAACTCCACGCACCTTTTTGTGGATCGTGACCCCATGTCAGGCGAGCTACCCCC

Taxonomic Information

Plant ID: NPO26571
Plant Latin Name: Ilex Paraguariensis
Taxonomy Genus: Ilex
Taxonomy Family: Aquifoliaceae

Plant External Links:

NCBI TaxonomyDB: 185542
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

18 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

6 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC98356

Ingredient ID: NPC97690

Ingredient ID: NPC51700

Ingredient ID: NPC49395

Ingredient ID: NPC477292

Ingredient ID: NPC477291

Ingredient ID: NPC477290

Ingredient ID: NPC477288

Ingredient ID: NPC316375

Ingredient ID: NPC309788

Ingredient ID: NPC280914

Ingredient ID: NPC280447

Ingredient ID: NPC274050

Ingredient ID: NPC208365

Ingredient ID: NPC179381

Ingredient ID: NPC1363

Ingredient ID: NPC113989

Ingredient ID: NPC112367

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Nuclear hormone receptor subfamily 1	RORC	Nuclear receptor ROR-gamma	P51449	CHEMBL1741186
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Transcription factor	RELA	Nuclear factor NF-kappa-B p65 subunit	Q04206	CHEMBL5533

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	3

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT03216876	A Study Of Ursolic Acid For Primary Sclerosing Cholangitis	sclerosing cholangitis	Ursolic Acid (NPC51700)	NP level
NCT04403568	Testing the Synergism of Phytonutrients, Curcumin and Ursolic Acid, to Target Molecular Pathways in the Prostate	prostate cancer	Ursolic Acid (NPC51700)	NP level
NCT02337933	Effect of Ursolic Acid Administration on Insulin Sensitivity and Metabolic Syndrome	metabolic syndrome	Ursolic Acid (NPC51700)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	RELA,RORC
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	RELA,RORC
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	RORC,RELA
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	RECQL,CES1
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	RELA
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	RELA
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	RELA
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
Autoimmune disease Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40-4A45	RORC
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	RELA
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	RELA
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	RELA
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	RELA
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	RORC
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	CES1
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	CES1
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	RORC
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	RELA
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	RELA
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	RELA
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	RELA
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	RELA
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	RELA
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	NCT02337933
Primary sclerosing cholangitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB96.2	NCT03216876
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	NCT04403568
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	RORC
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	RORC
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	RORC
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	RECQL
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	RECQL
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	RORC

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Ilex Paraguariensis

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

18 All known Ingredients in Total

6 Ingredients with Acceptable Bioavailablity

8 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Multiple sclerosis

Psoriasis

Solid tumour/cancer

Adenocarcinoma of pancreas

Lupus erythematosus

Diabetes mellitus, type unspecified

Atopic eczema

Peroxisomal disease

Autoimmune disease

Choreiform disorder

Muscular dystrophy

Rheumatoid arthritis

Fungal infection

Crohn disease

Chronic arterial occlusive disease

Synthesis disorder

Hyper-lipoproteinaemia

Lung cancer

Acute/subacute hepatic failure

Type 2 diabetes mellitus

Skin and skin-structure infection

Acute myeloid leukaemia

Irritable bowel syndrome

Indeterminate colitis

Metabolic disorder

Primary sclerosing cholangitis

Prostate cancer

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Diffuse large B-cell lymphomas

Mesothelioma of pleura

Tetralogy of Fallot

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities