• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rubia Cordifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGCGGAAGGATCATTGTCGAATCCTGAACGGCTGACCGCGAACACGTTCCTGAAAACCGCGCGCGCGCGCCGGGGAGCTGGGCCGAGCCCGGCGAACCGCGCGCGCGCGCCAACCCCTAACTCTCGGCGCGGGAAGCGCCAAGGACTACTCGGAACGGATCCGGGCGGCGTCCCCCGCGGCTTCCGCGGCGGGATCCCCCGGCATCTGGTGAAACGTAAACCAACACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCTCGTCGCCACCCCCTCCTCCCCGTCCTCCGGGACGCTGGCTGGCAGCGGGGTGGCGGATGCTGGCCTCCCGTTCCCTCGCGGCGCGGCTGGCCCAAATGCGAGTCCCCCGGACAAGGGACGTCACGGCTTGAGGTGGTTGGACAAGTTTGTTTCATTCATTGAGGAGCCGTGACGGCCCCCGGGGCCCCCTCTTTTTAGACCCCATTGAGAGCAGTGGCCTCCGACCGCGACCCCA

Click for details-----ITS1

ATCCTGAATTCGGCTGACCGCGAACACGTTCCTGAAAACCGCGCGCGCGCCGCCGGGGAGCTGGGCCGAGCCCGGCGAACCGCGCGCGCGCGCCAACCCCTAACTCTCGGCGCGGGAAGCGCCAAGGACTACTCGGAACGGATCCGGGCGGCGTCCCCCGCGGCTTCCGCGGCGGGATCCCCCGGCATCTGGTGAAACGTAACCAACA

Click for details-----ITS2

ATCTCGTCGCCACCCCCCTCCTCCCTGGTTGATCCTCCGGGACGCCGGCTGGCAGCGGGGCGGCGGATGATGGCCTCCCGTTCCCCCGCGGCGCGGCTGGCCCAAATGTGCGAGCCCCCGGACGAGGGACGTCACGACTCCAGGTGGTTGGTTGGACTCCATTCATTCATTGAGGAGCCGTGACGGCCCCCGGGGCCCCCTCGACCCCATTGAGAGCACGCATGTGGCCTCCGACCGCGACCCCAGGTCAGGC
Taxonomic Information

Plant ID: NPO26542
Plant Latin Name: Rubia Cordifolia
Taxonomy Genus: Rubia
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 339321
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Africa; Tanzania; India; Rwanda; China; Kenya; South Korea

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM


Medicinal Functions:

Alterative; Anodyne; Antiphlogistic; Antitussive; Astringent; Diuretic; Emmenagogue; Expectorant; Febrifuge; Styptic; Tonic; Vulnerary

Geographical Distribution

South Africa; Tanzania; India; Rwanda; China; Kenya; South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

111 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


80 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

52 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96420

Ingredient ID: NPC95354

Ingredient ID: NPC94382

Ingredient ID: NPC91335

Ingredient ID: NPC89860

Ingredient ID: NPC87857

Ingredient ID: NPC80341

Ingredient ID: NPC73416

Ingredient ID: NPC73061

Ingredient ID: NPC69486

Ingredient ID: NPC69353

Ingredient ID: NPC68782

Ingredient ID: NPC60389

Ingredient ID: NPC55973

Ingredient ID: NPC53414

Ingredient ID: NPC53206

Ingredient ID: NPC5304

Ingredient ID: NPC52226

Ingredient ID: NPC50052

Ingredient ID: NPC485261

Ingredient ID: NPC485260

Ingredient ID: NPC485259

Ingredient ID: NPC485258

Ingredient ID: NPC485257

Ingredient ID: NPC485256

Ingredient ID: NPC485255

Ingredient ID: NPC485254

Ingredient ID: NPC473460

Ingredient ID: NPC473422

Ingredient ID: NPC471563

Ingredient ID: NPC471561

Ingredient ID: NPC471532

Ingredient ID: NPC471531

Ingredient ID: NPC46531

Ingredient ID: NPC44437

Ingredient ID: NPC42572

Ingredient ID: NPC40038

Ingredient ID: NPC35114

Ingredient ID: NPC328383

Ingredient ID: NPC324128

Ingredient ID: NPC322523

Ingredient ID: NPC322177

Ingredient ID: NPC32064

Ingredient ID: NPC31930

Ingredient ID: NPC31799

Ingredient ID: NPC313979

Ingredient ID: NPC301627

Ingredient ID: NPC298229

Ingredient ID: NPC29531

Ingredient ID: NPC294226

Ingredient ID: NPC289883

Ingredient ID: NPC280254

Ingredient ID: NPC273959

Ingredient ID: NPC269919

Ingredient ID: NPC269783

Ingredient ID: NPC269275

Ingredient ID: NPC266237

Ingredient ID: NPC259449

Ingredient ID: NPC257582

Ingredient ID: NPC250846

Ingredient ID: NPC249066

Ingredient ID: NPC248573

Ingredient ID: NPC24761

Ingredient ID: NPC242334

Ingredient ID: NPC241235

Ingredient ID: NPC23962

Ingredient ID: NPC238629

Ingredient ID: NPC235948

Ingredient ID: NPC235665

Ingredient ID: NPC233972

Ingredient ID: NPC232681

Ingredient ID: NPC222781

Ingredient ID: NPC219876

Ingredient ID: NPC216769

Ingredient ID: NPC211565

Ingredient ID: NPC211255

Ingredient ID: NPC207442

Ingredient ID: NPC204932

Ingredient ID: NPC199000

Ingredient ID: NPC19445

Ingredient ID: NPC19004

Ingredient ID: NPC189663

Ingredient ID: NPC187998

Ingredient ID: NPC185802

Ingredient ID: NPC182896

Ingredient ID: NPC182682

Ingredient ID: NPC182179

Ingredient ID: NPC179904

Ingredient ID: NPC179489

Ingredient ID: NPC179039

Ingredient ID: NPC176740

Ingredient ID: NPC16705

Ingredient ID: NPC165464

Ingredient ID: NPC164608

Ingredient ID: NPC161749

Ingredient ID: NPC161571

Ingredient ID: NPC15763

Ingredient ID: NPC15658

Ingredient ID: NPC153234

Ingredient ID: NPC142956

Ingredient ID: NPC142891

Ingredient ID: NPC142415

Ingredient ID: NPC13787

Ingredient ID: NPC136360

Ingredient ID: NPC136330

Ingredient ID: NPC132680

Ingredient ID: NPC130577

Ingredient ID: NPC130334

Ingredient ID: NPC125174

Ingredient ID: NPC121354

Ingredient ID: NPC110473