• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Capsella Bursa-Pastoris


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGATACCTGTCCAAAACAGAACGACCCGAGAACCAAAGATCACCACTCGCGGTAAGGCCGATTTCGTAACAGATTTCGTGCCTGCCGAATCCGTGGTTTCGCGTACCTTCCCGGTCGAGAGTTTTCTCTCGGTCTGGTCGTGCTCGTTGCTTCCGGATATCACAAAACCCCGGCACGAAAAGTGTCAAGGAACATGCAACCGAACGGCTATAGCATTCGCCTCCCCGGAGACGGTGTGTGCGCGGATGCTTAGCTGCGATATAAAGTCTAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO26429
Plant Latin Name: Capsella Bursa-Pastoris
Taxonomy Genus: Capsella
Taxonomy Family: Brassicaceae

Plant External Links:

NCBI TaxonomyDB: 3719
Plant-of-the-World-Online: 30092589-2

Used in Medicines

Country/Region:
India; Russia

Traditional Medicine System:
Indian Folk; Homeopathy


Medicinal Functions:

Antiscorbutic; Astringent; Cancer; Diuretic; Emmenagogue; Haemostatic; Homeopathy; Hypotensive; Oxytoxic; Stimulant; Vasoconstrictor; Vasodilator; Vulnerary

Geographical Distribution

Brazil; Turkey; Italy; Bangladesh; Kenya; Sudan; Nepal; France; Ethiopia; Rwanda; Ireland; Bolivia; Norway; Ecuador; Saudi Arabia; Belarus; Algeria; Cuba; Iceland; Austria; Russia; United States; Zimbabwe; Germany; Chile; Belgium; Dominican Republic; Tanzania; Spain; Ukraine; Eritrea; Netherlands; Uganda; Libya; Pakistan; Denmark; Poland; Finland; Mauritius; Morocco; Sweden; Namibia; Japan; Switzerland; Haiti; Bulgaria; Jamaica; Romania; Albania; Honduras; Portugal; Mexico; Egypt; South Africa; India; Peru; Lesotho; Djibouti; Tunisia; Colombia; Greece; Burundi; Hungary; Taiwan; Cyprus

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

91 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


66 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

44 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC92507

Ingredient ID: NPC86412

Ingredient ID: NPC8416

Ingredient ID: NPC81989

Ingredient ID: NPC78500

Ingredient ID: NPC74881

Ingredient ID: NPC72258

Ingredient ID: NPC69245

Ingredient ID: NPC64946

Ingredient ID: NPC60675

Ingredient ID: NPC58957

Ingredient ID: NPC5738

Ingredient ID: NPC53028

Ingredient ID: NPC50934

Ingredient ID: NPC49151

Ingredient ID: NPC45960

Ingredient ID: NPC4596

Ingredient ID: NPC45386

Ingredient ID: NPC42471

Ingredient ID: NPC42403

Ingredient ID: NPC35381

Ingredient ID: NPC34764

Ingredient ID: NPC327756

Ingredient ID: NPC32420

Ingredient ID: NPC323956

Ingredient ID: NPC32279

Ingredient ID: NPC319287

Ingredient ID: NPC309862

Ingredient ID: NPC302611

Ingredient ID: NPC297732

Ingredient ID: NPC295777

Ingredient ID: NPC288714

Ingredient ID: NPC287331

Ingredient ID: NPC283682

Ingredient ID: NPC282754

Ingredient ID: NPC278126

Ingredient ID: NPC275716

Ingredient ID: NPC275462

Ingredient ID: NPC271588

Ingredient ID: NPC266501

Ingredient ID: NPC262505

Ingredient ID: NPC256186

Ingredient ID: NPC255607

Ingredient ID: NPC254779

Ingredient ID: NPC254221

Ingredient ID: NPC252553

Ingredient ID: NPC251990

Ingredient ID: NPC250734

Ingredient ID: NPC250539

Ingredient ID: NPC240328

Ingredient ID: NPC2355

Ingredient ID: NPC230221

Ingredient ID: NPC228776

Ingredient ID: NPC224874

Ingredient ID: NPC224651

Ingredient ID: NPC224556

Ingredient ID: NPC218010

Ingredient ID: NPC216341

Ingredient ID: NPC214884

Ingredient ID: NPC194465

Ingredient ID: NPC189178

Ingredient ID: NPC187522

Ingredient ID: NPC187058

Ingredient ID: NPC184373

Ingredient ID: NPC18259

Ingredient ID: NPC18205

Ingredient ID: NPC179831

Ingredient ID: NPC175775

Ingredient ID: NPC174406

Ingredient ID: NPC163556

Ingredient ID: NPC1591

Ingredient ID: NPC156768

Ingredient ID: NPC150642

Ingredient ID: NPC149436

Ingredient ID: NPC149070

Ingredient ID: NPC145022

Ingredient ID: NPC144939

Ingredient ID: NPC144407

Ingredient ID: NPC143880

Ingredient ID: NPC140364

Ingredient ID: NPC13402

Ingredient ID: NPC130760

Ingredient ID: NPC125731

Ingredient ID: NPC116957

Ingredient ID: NPC116387

Ingredient ID: NPC11185

Ingredient ID: NPC108779

Ingredient ID: NPC108218

Ingredient ID: NPC107135

Ingredient ID: NPC104543

Ingredient ID: NPC101718