• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Sorghum Bicolor


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GACGACCCGTGACCAAAGATCACCACTCCTGGTGGGCTGGTTTCTTAGCTGATGCCTTGTCCACTGGATCCGTGGTTTCATGTTTTGCTAGGTCGGGTGATCCTACCCGATCTTGCAATGCAAGTAACTTCCGGATTTCACAAAATCCCGACACAAAACGTGTCAAGGAATATACAACCTAAATAGCCAACATTCGCCCCATTGGAGACAATGTGCGCGCGGATGCTGAGCTAAATATAAAGTCTAATACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCTGGCCGGGGCACGTCTGCCTGGGTGTCACAACTTGCGTCACTCTATGCGCCAACCAAGCTCAAACCATTATATGGGTATTGGTATGTGCGGATGTGGATATTGACCCTTCGTGCTTTTAATGTGCGGCGGGTTTAAGTGATTGTCATTGCTAGGTTTTCATGCGGCGAATGGTGGATAGATTATAACATCAAACCTCCAGTTGTGCACGTTACTCCTAACTGTGACTTACAAGAAGTATAACCCATAACGATGTTTGCATTTTTTGCAAACTCGGACCATGACCTCAG

Click for details-----ITS1

GACGACCCGTGACCAAAGATCACCACTCCTGGTGGGCTGGTTTCTTAGCTGATGCCTTGTCCACTGGATCCGTGGTTTCATGTTTTGCTAGGTCGGGTGATCCTACCCGATCTTGCAATGCAAGTAACTTCCGGATTTCACAAAATCCCGACACAAAACGTGTCAAGGAATATACAACCTAAATAGCCAACATTCGCCCCATTGGAGACAATGTGCGCGCGGATGCTGAGCTAAATATAAAGTCTAATA

Click for details-----ITS2

ATCGTGTCGCCCCCTACCACTCCTCAAATGGATGTTTGGTGTGGGGGCGGATATTGGTCTCCCGTTTCTCCGATACGGTTGGCCAAAATACGAGTCCCCATCGATGGACGCACGACTAGTGGTGGTTGATAAAACCTTCGTCTTTTGTTGTGCATCTTCATTCGTACGGGATGCTTAAAGACYCCAATGTGTTGTCTTATGATGACGCTTCGACCGCGA
Taxonomic Information

Plant ID: NPO26371
Plant Latin Name: Sorghum Bicolor
Taxonomy Genus: Sorghum
Taxonomy Family: Poaceae

Plant External Links:

NCBI TaxonomyDB: 4558
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Madagascar; Italy; South Africa; Tanzania; Jordan; India; United States; Zimbabwe; Rwanda; Angola; Swaziland; Kenya

Traditional Medicine System:
Indian Folk; Unani; Ayurveda; Siddha


Medicinal Functions:

Astringent; Demulcent; Diuretic; Haemostatic

Geographical Distribution

Madagascar; Italy; South Africa; Tanzania; India; Zimbabwe; United States; Rwanda; Jordan; Swaziland; Kenya; Angola

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

83 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


53 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

50 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94743

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC93817

Ingredient ID: NPC87571

Ingredient ID: NPC85813

Ingredient ID: NPC81099

Ingredient ID: NPC78437

Ingredient ID: NPC67101

Ingredient ID: NPC62045

Ingredient ID: NPC50898

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC489903

Ingredient ID: NPC489899

Ingredient ID: NPC48623

Ingredient ID: NPC474619

Ingredient ID: NPC328447

Ingredient ID: NPC32441

Ingredient ID: NPC317120

Ingredient ID: NPC3120

Ingredient ID: NPC311403

Ingredient ID: NPC311000

Ingredient ID: NPC295644

Ingredient ID: NPC294548

Ingredient ID: NPC291062

Ingredient ID: NPC290089

Ingredient ID: NPC284475

Ingredient ID: NPC28318

Ingredient ID: NPC281686

Ingredient ID: NPC279121

Ingredient ID: NPC279026

Ingredient ID: NPC277445

Ingredient ID: NPC272614

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC269221

Ingredient ID: NPC263382

Ingredient ID: NPC262673

Ingredient ID: NPC259631

Ingredient ID: NPC25760

Ingredient ID: NPC249067

Ingredient ID: NPC242580

Ingredient ID: NPC237812

Ingredient ID: NPC230301

Ingredient ID: NPC226453

Ingredient ID: NPC221612

Ingredient ID: NPC220935

Ingredient ID: NPC208793

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC196776

Ingredient ID: NPC185755

Ingredient ID: NPC18469

Ingredient ID: NPC174246

Ingredient ID: NPC171156

Ingredient ID: NPC169903

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC159952

Ingredient ID: NPC158654

Ingredient ID: NPC155263

Ingredient ID: NPC154186

Ingredient ID: NPC152451

Ingredient ID: NPC151113

Ingredient ID: NPC150950

Ingredient ID: NPC149803

Ingredient ID: NPC149300

Ingredient ID: NPC147983

Ingredient ID: NPC137958

Ingredient ID: NPC137167

Ingredient ID: NPC133742

Ingredient ID: NPC130683

Ingredient ID: NPC129224

Ingredient ID: NPC126681

Ingredient ID: NPC124893

Ingredient ID: NPC117572

Ingredient ID: NPC11433

Ingredient ID: NPC113733

Ingredient ID: NPC112890

Ingredient ID: NPC112596