• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Agastache Rugosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTATAAAGCAGACCGCGAACCCATGAATAACTAACGACGCGTGGTGCGGCGTGGGGACAACCCCCCATCGAGCCACCGTATCCCTGCCGGTGTGCTCCCTCGGGTCGCGTCGTGCGGGCTAACGAACCCTGGCGCGGAATGCGCCAAGGAGAACAAAAACGAAGCGTCCACCTCCCGCACCCCATCCGCAGAGTGTGTGGGGGATCGGCCGTCTATCAAAATGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCTCCCTCCCCGTGCAAGACGCGGCCGAGGTAGGGTGGATATTGGCCCCCCGTGTGCCCCGGCATGCAGTTGGCCCAAATACGATCCCTCGGCGACTCGTGTCACGACAAGTGGTGGTTGAACTTATCAATCTCGGGCCGTTGTGCTACTGCGTCATTCGATCGGGCATCATTGAATGACCCAATGTTGTCGGTGCCTCACAGCTCACCACCTTCGA

Click for details-----ITS1

TCGAAACCTATAAAGCAGACCGCGAACCCATGAATAACTAACGACGCGTGGTGCGGCGTGGGGACAACCCCCCATCGAGCCACCGTATCCCTGCCGGTGTGCTCCCTCGGGTCGCGTCGTGCGGGCTAACGAACCCTGGCGCGGAATGCGCCAAGGAGAACAAAAACGAAGCGTCCACCTCCCGCACCCCATCCGCAGAGTGTGTGGGGGATCGGCCGTCTATCAAAATGTCATAA

Click for details-----ITS2

ATCGCGTCGCCCCCCTCCCCGCGCACAGCGCGGCCGAGGTGGGGCGGATATTGGCCCCCCGTGTGCCCCGGCACGCGGTCGGCCCAAATGCGATCCCTCGGCGACTCGTGTCGCGACAAGTGGTGGTTGAACTCATCAATCTCGCGCCGTCGTGCTACTGCGTCGTCCGATCGGGCATCATTGAACGACCCAACGGTGTCGGTGCCTCACGGCTCACCACCTTCGACCGCGACCTACAGTACAGGACGGAGCCCGATC
Taxonomic Information

Plant ID: NPO26351
Plant Latin Name: Agastache Rugosa
Taxonomy Genus: Agastache
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 39271
Plant-of-the-World-Online: n.a.

Used in Medicines

Unknown.

Geographical Distribution
Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

147 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


111 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

93 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC95381

Ingredient ID: NPC95090

Ingredient ID: NPC93843

Ingredient ID: NPC91574

Ingredient ID: NPC88566

Ingredient ID: NPC86538

Ingredient ID: NPC85813

Ingredient ID: NPC84319

Ingredient ID: NPC80188

Ingredient ID: NPC78551

Ingredient ID: NPC78326

Ingredient ID: NPC76145

Ingredient ID: NPC7568

Ingredient ID: NPC75584

Ingredient ID: NPC7491

Ingredient ID: NPC7314

Ingredient ID: NPC71853

Ingredient ID: NPC71703

Ingredient ID: NPC68889

Ingredient ID: NPC67037

Ingredient ID: NPC66577

Ingredient ID: NPC63121

Ingredient ID: NPC62765

Ingredient ID: NPC61828

Ingredient ID: NPC61779

Ingredient ID: NPC61769

Ingredient ID: NPC61

Ingredient ID: NPC60589

Ingredient ID: NPC60556

Ingredient ID: NPC60288

Ingredient ID: NPC57879

Ingredient ID: NPC57877

Ingredient ID: NPC52005

Ingredient ID: NPC51189

Ingredient ID: NPC50898

Ingredient ID: NPC479771

Ingredient ID: NPC479770

Ingredient ID: NPC479769

Ingredient ID: NPC479768

Ingredient ID: NPC479767

Ingredient ID: NPC479766

Ingredient ID: NPC479765

Ingredient ID: NPC479764

Ingredient ID: NPC479763

Ingredient ID: NPC46202

Ingredient ID: NPC43114

Ingredient ID: NPC4079

Ingredient ID: NPC36408

Ingredient ID: NPC34764

Ingredient ID: NPC328719

Ingredient ID: NPC323787

Ingredient ID: NPC323434

Ingredient ID: NPC323422

Ingredient ID: NPC322715

Ingredient ID: NPC320941

Ingredient ID: NPC320443

Ingredient ID: NPC318997

Ingredient ID: NPC31371

Ingredient ID: NPC312132

Ingredient ID: NPC309182

Ingredient ID: NPC307063

Ingredient ID: NPC300649

Ingredient ID: NPC295442

Ingredient ID: NPC292792

Ingredient ID: NPC290189

Ingredient ID: NPC290078

Ingredient ID: NPC289366

Ingredient ID: NPC287731

Ingredient ID: NPC287335

Ingredient ID: NPC279121

Ingredient ID: NPC2785

Ingredient ID: NPC276222

Ingredient ID: NPC271321

Ingredient ID: NPC270849

Ingredient ID: NPC26906

Ingredient ID: NPC268164

Ingredient ID: NPC267091

Ingredient ID: NPC259512

Ingredient ID: NPC259182

Ingredient ID: NPC257124

Ingredient ID: NPC254156

Ingredient ID: NPC252539

Ingredient ID: NPC249815

Ingredient ID: NPC243891

Ingredient ID: NPC24294

Ingredient ID: NPC236355

Ingredient ID: NPC235341

Ingredient ID: NPC231772

Ingredient ID: NPC231738

Ingredient ID: NPC23145

Ingredient ID: NPC22832

Ingredient ID: NPC227049

Ingredient ID: NPC226596

Ingredient ID: NPC226250

Ingredient ID: NPC22484

Ingredient ID: NPC220860

Ingredient ID: NPC220169

Ingredient ID: NPC219163

Ingredient ID: NPC218918

Ingredient ID: NPC216630

Ingredient ID: NPC216361

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC213749

Ingredient ID: NPC210015

Ingredient ID: NPC210003

Ingredient ID: NPC209275

Ingredient ID: NPC2003

Ingredient ID: NPC197356

Ingredient ID: NPC19470

Ingredient ID: NPC19460

Ingredient ID: NPC189142

Ingredient ID: NPC184049

Ingredient ID: NPC180871

Ingredient ID: NPC18074

Ingredient ID: NPC175987

Ingredient ID: NPC173637

Ingredient ID: NPC169749

Ingredient ID: NPC168799

Ingredient ID: NPC166923

Ingredient ID: NPC166692

Ingredient ID: NPC16157

Ingredient ID: NPC155209

Ingredient ID: NPC155182

Ingredient ID: NPC150610

Ingredient ID: NPC150329

Ingredient ID: NPC14917

Ingredient ID: NPC142415

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC137949

Ingredient ID: NPC13789

Ingredient ID: NPC131769

Ingredient ID: NPC124885

Ingredient ID: NPC123229

Ingredient ID: NPC122962

Ingredient ID: NPC121322

Ingredient ID: NPC120926

Ingredient ID: NPC114239

Ingredient ID: NPC109813

Ingredient ID: NPC106250

Ingredient ID: NPC105509

Ingredient ID: NPC105246

Ingredient ID: NPC10455

Ingredient ID: NPC101285

Ingredient ID: NPC100879